EST details — SGN-C181894
Search information |
Request: 181894 | Match: SGN-C181894 |
Request From: SGN database generated link | Match Type: cDNA clone internal identifier |
Clone information |
SGN ID: SGN-C181894 | Clone name: TUS-38-C12 |
| ||
Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C181894 is on microarray TOM1 spot ID 1-1-5.3.10.11 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C6530 [cLEC-35-L2] | Trace: SGN-T30739 | EST: SGN-E210391 | Direction: 5' | Facility: TIGR |
Clone: SGN-C181894 [TUS-38-C12] | Trace: SGN-T199380 | EST: SGN-E398054 | Direction: 3' | Facility: INRA |
Sequence |
Sequence Id: SGN-E393242 | Length: 212 bp (916 bp untrimmed) |
Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E393242 [] (trimmed)
AACAATCTAAGCAGTAGTACTCCCATTTTGCTAGCTCTGGTTCTCTGCATTAGCCTAACCTCTGTTACCAACGCGCAACAATGCGGAAGGCAAAG
GGGCGGAGCATTATGTGGTGGCAACTTGTGTTGCAGTCAATTCGGGTGGTGTGGATCGACTCCCGAATATTGTACACCTAGCCAAAGTTGCCAAA
GCCTTTTGCATAGGTGCACCTA
GGGCGGAGCATTATGTGGTGGCAACTTGTGTTGCAGTCAATTCGGGTGGTGTGGATCGACTCCCGAATATTGTACACCTAGCCAAAGTTGCCAAA
GCCTTTTGCATAGGTGCACCTA
Unigenes |
Current Unigene builds | |||||
[SGN-E393242] | SGN-U567805 | Tomato 200607 | Build 2 | 44 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T194568 [Download][View] | Facility Assigned ID: FA0AAD26BB06RM1 |
Submitter: Koni | Sequencing Facility: INRA |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.971 | Expected Error Rate: 0.0061 | Quality Trim Threshold: 14.5 |