Notice: the solgenomics has been unstable, we apologize for the inconvenience.

EST details — SGN-C180679

Search information 
Request: 180679Match: SGN-C180679
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C180679Clone name: TUS-34-P21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180679 is on microarray TOM1 spot ID 1-1-4.4.19.15 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C32685 [cLEG-20-P5] Trace: SGN-T67487 EST: SGN-E252637 Direction: 5' Facility: TIGR
Clone: SGN-C180679 [TUS-34-P21] Trace: SGN-T187111 EST: SGN-E375209 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E375210Length: 447 bp (915 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E375210 [] (trimmed) CTGAACTCCCTTCGTCTCCATCCAGACAAAAACCGAGCCATCCATCACGCTACCACTCTCCAACAACCCCTTCCAAGCCAACCACTTCAGTAGCA
GCAGCCAGAAAACTGAAACCAGCAAGCCCGAGAATTAGTGCAATGAACCAAGATGATGATAACCGAAGCATGCTTAGCGTGCAGTCAGAACGGAA
CAGGAGGCATAGCATAGCAGGATCATCTATAAGAGACGACGAGAGCCTGGCAAGCTCGCCTTCAGTCCCAAGTTACATGGCGTCCACTCAGTCTG
CAAAGGCCAAAACACGGTTGCAAAATCCATTAGGCATGGAAAATGGCAAACCAGANAAAGGATCAGCAGGGTCTGTGAAGAAGCGGCTCTCTTAT
CCACCGTCACCTGCCAGAACAAGGCGGCATTCAGGCCCACCAAAGTTTGACAACACCTCTTTGAACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E375210] SGN-U575982 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T187112 [Download][View] Facility Assigned ID: FA0AAD22CH11RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0121 Quality Trim Threshold: 12.5