EST details — SGN-C180607
| Search information |
| Request: 180607 | Match: SGN-C180607 |
| Request From: SGN database generated link | Match Type: cDNA clone internal identifier |
| Clone information |
| SGN ID: SGN-C180607 | Clone name: TUS-34-M21 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C180607 is on microarray TOM1 spot ID 1-1-4.1.19.15 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C27759 [cLEF-45-H10] | Trace: SGN-T61501 | EST: SGN-E246766 | Direction: 5' | Facility: TIGR |
| Sequence |
| Sequence Id: SGN-E378785 | Length: 75 bp (1113 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E378785 [] (trimmed - flagged)
AACTCCCTCACACTCTCGATAACTGTCTCCCCCAAGAGCCGATTGTCCCCGCCAGGTAGTGCTCGCAGATGGGTT
| Unigenes |
| Current Unigene builds | |||||
| No current unigene builds incorporate this sequence |
| Chromatogram |
| SGN-ID: SGN-T1633 [Download][View] | Facility Assigned ID: TUS34M21.ab1 |
| Submitter: Koni | Sequencing Facility: Giov. Lab |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
| Problems: | Too short after trimming low-quality bases |
| Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: 0 |
Working
