EST details — SGN-C180387

Search information 
Request: 180387Match: SGN-C180387
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C180387Clone name: TUS-34-D17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180387 is on microarray TOM1 spot ID 1-1-8.4.19.12 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C45876 [cLEG-9-J4] Trace: SGN-T65689 EST: SGN-E251606 Direction: 5' Facility: TIGR
Clone: SGN-C180387 [TUS-34-D17] Trace: SGN-T187128 EST: SGN-E375226 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E375227Length: 376 bp (954 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E375227 [] (trimmed) TTCAAACCTATACAAAATAGGAACAAATTTGAAGAGAAAAAAATAAAAAAAAATCTCTAAGTTTTTTTTTTCTTCTTTTCGATACAAGACGATAT
GGTTTTTCCTATTAATCAGGAATTACTTGTCGATGAGTCGTCTTCTCAGTTGAGAAAAACAAGTGGAGGAACTGGTGGAGGAGGTAGAGGGAAGA
TTGAAATTAAAAGGATCGAAAATACGACAAATCGACGAGTTACGTTCTGCAAGCGTAGAAATGGGCTATTGAAAAAAGCTGATGAACTTTCTGTT
CTTTGTGATGCTGAAGTTTCACTAATTGTATTTTCCAGCCGCGGCCGTCTCTATGAATATGCCACTAACAGTGCTAGGGCAACTATTGATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E375227] SGN-U581068 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T187129 [Download][View] Facility Assigned ID: FA0AAD22CB09RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.919 Expected Error Rate: 0.0083 Quality Trim Threshold: 14.5