Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-C179171

Search information 
Request: 179171Match: SGN-C179171
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C179171Clone name: TUS-31-B1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179171 is on microarray TOM1 spot ID 1-1-8.2.2.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C76571 [cLES-18-H11] Trace: SGN-T101736 EST: SGN-E289294 Direction: 5' Facility: TIGR
Clone: SGN-C179171 [TUS-31-B1] Trace: SGN-T185439 EST: SGN-E373301 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E373213Length: 488 bp (890 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E373213 [] (trimmed) TTGAAATGGGACGCGAGAGTTATAGAGGTAGAAAGCAGTGATGAGAAGCTACTAATTTGCCAGAAACCATTTTCAAGAAGACAAGCTAGCTAAAA
ATTGGCAAGGATCTCAAGATTTGTAGATGATAATAGTCATTTGTTTGTTGGATCATATTAATTATTAAACAGCAAAAATTTCACACAGAAATGGC
GGTAACGAAAACGAAATTTTTTGGACAGTCAGAAAAGCAAGAGAGAGCACAAGAAGAGAAGACAACAGAATGGTTCTGCAAAGGGACCAAAACCA
CAACTCCTATGTAGCCGTAAGGCTTACATAGGGCCATGTAATTACACATTTGAGGCACAGTTGCAAATGGGAATTGTTTTAGGGGCTATAGTTTT
TTCCTTGTGATGTCTCATTTTATAACTATACAAGCAAAAACAATATGTTGATTGAAATTGTGAAGGTATTATAGAATAACAGCAATCCTAGCTGC
TGTATCTTATCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E373213] SGN-U565822 Tomato 200607 Build 2 34 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T185351 [Download][View] Facility Assigned ID: FA0AAD19CA01RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.935 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5