EST details — SGN-C178741

Search information 
Request: 178741Match: SGN-C178741
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C178741Clone name: TUS-29-P3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C178741 is on microarray TOM1 spot ID 1-1-6.4.4.16 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C70589 [cLER-15-F10] Trace: SGN-T95417 EST: SGN-E282897 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E371025Length: 381 bp (885 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E371025 [] (trimmed) AAAGATCAAGGAACAGTTGGATGCGGACACAGTCGTAGTGAAAGATGCTTATGGTGATGGTCGGCATGTCAGCATTGATGTAATCGCTACAGCTT
TTGAGGGACAATCAGCTGTGAATAGGCAGAGGATGGTCTACAAAGCCATATGGGAAGAACTTCAGAACACTGTGCATGCAGTCGACCAGATGACT
ACCAAAACACCAACTGAAGCAGCTGCAGGGAAGTGATAGAGGTACAACCTAAGAGTACCAAAACACCACCCCAGTCAACTACTTTATTTTCAAGT
AGCAAAACTTTTCAATTGACACATACAGTTACTATTAAAAAAAAAGAACATTGAATGATGTCAACTTTAAAGTAATATTGCTTTACATTGTTAGT
T
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E371025] SGN-U566173 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T184094 [Download][View] Facility Assigned ID: FA0AAD17CH02RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.925 Expected Error Rate: 0.0003 Quality Trim Threshold: 12.5