Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-C178497

Search information 
Request: 178497Match: SGN-C178497
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C178497Clone name: TUS-29-E23
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C178497 is on microarray TOM1 spot ID 1-1-2.1.3.1 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72133 [cLER-1-E13] Trace: SGN-T92036 EST: SGN-E280482 Direction: 5' Facility: TIGR
Clone: SGN-C72133 [cLER-1-E13] Trace: SGN-T92037 EST: SGN-E280483 Direction: 3' Facility: TIGR
Clone: SGN-C178497 [TUS-29-E23] Trace: SGN-T183768 EST: SGN-E370427 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E370428Length: 365 bp (854 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E370428 [] (trimmed) CAAATCCATATTATCAAACTTCATACACATAAGGCACATACATATGCACTTACATACAGAAATATCAAATACAGTACTAACAATTATCCTTCAGA
ATCCAAAAAAAACAAAAGTGAAGGAAATTAAAAACACTTAAAAACCAAAACAACACAGAAACACAATCATAACATCCCAAAAGTAAAATTAAAAA
AACATTTCATTTCATTTAGTCTTTTTCCTTCTCCTTTTCCTCTTCAGCCTTTGAGTGGTATCCTGGTAATTTCTCCTTAATTTTGTCCAAAAATC
CCTTCTTCTCCTTCCCCTCCGCCTCATGCTCCACCGCAGCCGGTGGTGGTGGTGGNGGTGCTATGATTGTGTTTGTGTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E370428] SGN-U581375 Tomato 200607 Build 2 231 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T183769 [Download][View] Facility Assigned ID: FA0AAD17AC12RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.914 Expected Error Rate: 0.0001 Quality Trim Threshold: 14.5