Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-C177832

Search information 
Request: 177832Match: SGN-C177832
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C177832Clone name: TUS-27-J6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C177832 is on microarray TOM1 spot ID 1-1-3.2.6.9 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C64092 [cLEM-5-B24] Trace: SGN-T85266 EST: SGN-E271461 Direction: 5' Facility: TIGR
Clone: SGN-C177832 [TUS-27-J6] Trace: SGN-T193276 EST: SGN-E391950 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E391700Length: 473 bp (842 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E391700 [] (trimmed) GGAAATTACTTCAGATACCTGGATCGAGATTGCTCTTTGGTGGTGAAGCCTTACAGAACCATTCGATCCCAAAAATTTATGGAGCCATTAAGCCC
ACTGCTATTTTTGTACCTCTTGAAGAAATACTCAAAGATGAACATTATCCTCTCGTGACCAAAGAGATTTTTGGGCCATTCCAGGTTGTGACTGA
GTACAAAGATAATCAGCTTCCACTGGTCCTCGATGCCCTTGAAAAGATGCATGCACATTTAACAGCTGCTGTGGTTTCCAATGATATATTGTTCC
TGCAAAAAGTGATTGGAAATTCAGTTAATGGAACCACTTATGCTGGATTGAGAGCAAGAACAACAGGGGCTCCCCAGAATCACTGGTTTGGTCCT
GCCGGGGACCCCATAGGAGCCGGAATAGGTACTCCAGAAGCTATTAAACTTGTATGGTCTTGCCACAGAATAAATCATCTATGATGTTGGTCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E391700] SGN-U571120 Tomato 200607 Build 2 32 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T193026 [Download][View] Facility Assigned ID: FA0AAD15DE03RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0062 Quality Trim Threshold: 14.5