EST details — SGN-C177589

Search information 
Request: 177589Match: SGN-C177589
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C177589Clone name: TUS-26-P3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C177589 is on microarray TOM1 spot ID 1-1-6.4.7.19 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C37745 [cLEG-42-P5] Trace: SGN-T72493 EST: SGN-E259732 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E369997Length: 336 bp (922 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E369997 [] (trimmed) AGAAGCGTACCTGGAACACATGGCCCGCACGCTGACTACCCGGGAGGAGCATCTGGCGGGGTGCTCGGTGTTAAACCACGCAGAGCAGCGTCAAA
TGGATGAGCGTGCGCGCTATCTGGAAAGCGAGGAAGCCCATGTGCGCAACCGTGAGCGGTTGGTTGGTCACAGGGAGCAACAACTTACGGCTGCA
CTGGTTCAGTTGCCTGCCCTGCGGGAAAACCTGAGGGGCGTGCTTCAAACCTTGGACGAGTCGCTTGCACGGCTGGCTGAGACCGGACGCAGCCA
GCCTGAAAGCCGGCCACTTCAGCTGGATGCAGATTGACGCTGGGGGTAGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E369997] SGN-U569039 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T182611 [Download][View] Facility Assigned ID: FA0AAD14CH02FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.922 Expected Error Rate: 0.0094 Quality Trim Threshold: 20.5