EST details — SGN-C175967

Search information 
Request: 175967Match: SGN-C175967
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C175967Clone name: TUS-22-L13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175967 is on microarray TOM1 spot ID 1-1-4.4.11.10 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C17524 [cLED-19-P16] Trace: SGN-T53508 EST: SGN-E237594 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E367964Length: 246 bp (910 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E367964 [] (trimmed) CAGGTACAGTCACGAGCTTGACATGGTATTGCTATACAGATAGTTGATCAGGGAACGAGTCGGTAGCTACATTTGCAACTGGGTACCATGTTTTC
TTTTCCTGGTTTGACTGAGAATCCGCTGTTACAACTTTACCATGTTGTACTGCCTTTACCATCGAACCAAAGAATTGGAAACCATGCTGGCCTTC
TGCTTTTTAGCATGAGGTACAGACATGTAGACTCCTGGAAAGTTGTGTAATTTTAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E367964] SGN-U566700 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T180713 [Download][View] Facility Assigned ID: FA0AAD10CF07RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0037 Quality Trim Threshold: 14.5