EST details — SGN-C175810

Search information 
Request: 175810Match: SGN-C175810
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C175810Clone name: TUS-22-E24
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175810 is on microarray TOM1 spot ID 1-1-1.1.11.13 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C16835 [cLED-17-L24] Trace: SGN-T53056 EST: SGN-E238614 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E368074Length: 134 bp (911 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E368074 [] (trimmed) CAGTTATTCTTTGGGACCGGCAGATCTCCTTTTTGGTGGGCAGGCAACTGGGATGAAGAGTCTACCGATAATTTTAGACAGTGGAAGTACCTTTA
CCTACTTCAATTCCGAACCTTACACAACTCTGTTGTCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E368074] SGN-U583865 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T180553 [Download][View] Facility Assigned ID: FA0AAD10BC12RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.940 Expected Error Rate: 0.0057 Quality Trim Threshold: 14.5