Notice: the solgenomics has been unstable, we apologize for the inconvenience.

EST details — SGN-C175529

Search information 
Request: 175529Match: SGN-C175529
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C175529Clone name: TUS-21-J7
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175529 is on microarray TOM1 spot ID 1-1-2.2.13.12 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C15425 [cLED-11-O14] Trace: SGN-T51516 EST: SGN-E235506 Direction: 5' Facility: TIGR
Clone: SGN-C175529 [TUS-21-J7] Trace: SGN-T190535 EST: SGN-E377773 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E377774Length: 702 bp (932 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E377774 [] (trimmed) ACAAATTATAAGAGGCTGAAATGAATATATTATCGCTGTCAGCCTATTATTGCAGTGAGTTTTTTCCTTCTTTGATGATTCCGATTATCTCCCAC
TAATCCATTTCCCCGATTCAACCAATCCCAAACCTTACGGGAAATAGTTGTGTCTTGATTGATTCATGACTAACTCTTTTAGGAAGAAGTATGAA
GTCTTTTTTCCCCCTCTATTTTATTATGTTTTTCAATACTATCCTCAGCCAAAAGCAACAATAACAATTACGCCTCAATCCGAAACAGGTATTTT
CAACCAAGATACACGATTTAAACTTGTTTATGACATGCTGTCCAACTGTGAAATGCTTCATAGAGAGCGGTGGCGGAAAACATGTACATGTGATA
TAATTTGTTGAGGTTACACTCCCATCACAGTGCTACTGTAATCCATATATATTGTTGGCGGCTATCCCGTGAAGTTTAGAACTTCTTGCTCTTCA
GGTTTCTTTTTTCACTTTCTTACCTTTCTCATGTCATGGACAACGTAGTTCAAATGTCGAAATTTTGTTGATTTTGATTATTGAGTTTTTTTGTT
CTACTATTATCTAGTCAGTGACAAGACAGTAAAAATTAGAGCTTTTCAAGTTGTGAAAATGTTGTTTTTTCTTACAAAGTGATGTACTTTTGTTT
GACTGCTTATGCTGAGTTATCGCGTCACGCTTCTCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E377774] SGN-U584124 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T190536 [Download][View] Facility Assigned ID: FA0AAD9CE04RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0028 Quality Trim Threshold: 14.5