| SGN ID: SGN-C1754 | Clone name: cLEC-13-M24 |  | Order Clone |
|
| Library Name: cLEC | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination
Microarray: Alias clone
SGN-C184961 is on microarray TOM1: SGN-S1-1-2.3.12.13
There is no map position defined on SGN for this EST or others in the same unigene.
| Sequence Id: SGN-E204208 | Length: 180 bp (1048 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E204208 [] (trimmed)
CCTAGCACCACCAGCAGCAGCAGCAGCACTAGGAGGTTCTTGATTACTAGCAATGGGTCTTCTTGCCGGCGGCGCCCCAATATTTCCACTGAAGA
CCAACCCTGTTCCTCTTCAGCCTGTTATCAAGGGGCAGTGCAGTCTTATGGTCTGCAGAGGCAACGAGTACAATTAAATGGGATA
[BLAST] [AA Translate]
| SGN-ID: SGN-T25961 [Download][View] |
Facility Assigned ID: TCABX84THB
|
| Submitter: Koni |
Sequencing Facility: TIGR |
Funding Organization: National Science Foundation
| Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
| Sequence Entropy: 0.971 |
Expected Error Rate: 0.0052 |
Quality Trim Threshold: 14.5 |
