EST details — SGN-C175146

Search information 
Request: 175146Match: SGN-C175146
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C175146Clone name: TUS-20-J8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175146 is on microarray TOM1 spot ID 1-1-1.2.14.21 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C24006 [cLED-6-O9] Trace: SGN-T50037 EST: SGN-E233051 Direction: 5' Facility: TIGR
Clone: SGN-C175146 [TUS-20-J8] Trace: SGN-T190133 EST: SGN-E377911 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E377912Length: 291 bp (937 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E377912 [] (trimmed) TTTTAACTCTTCCATTTACTTATCCTATTTAATGTCATGGTATTTCATGATAGATGGATTAGTGTCTGACAATTGATCTGATTATGTGTCCTTCA
ACTATATATGAGTTTTGGGATAATGTAGTCTTTTATTGTCAGATTTATATACATTAACATGTAAAATTAGAGGGAACTTTCAGTTCTGTGTTGTA
CTATTACAATGATAGCTCTAGTGTCGTTGATGTAAGACAATATCTACTCTTTCAATCACTTAATGTAAGAATCAAGACTTCATCTAATCAAATAT
TAGCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E377912] SGN-U564952 Tomato 200607 Build 2 63 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T190134 [Download][View] Facility Assigned ID: FA0AAD8DE04RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.896 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5