EST details — SGN-C17446

Search information 
Request: 17446Match: SGN-C17446
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C17446Clone name: cLED-19-L15
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C185901 is on microarray TOM1: SGN-S1-1-6.2.7.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E237707Length: 376 bp (801 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E237707 [] (trimmed) AGCAACAAAAAACAAGCACAAAGTCCAATATTATTCATTGTTAATTTTTATCTTCCAACTACAAAACAAATAAAGAAGGCATGATAATGACATAT
TTCTGGTCTGTACAAAACAAAAGGACCATACATATTACTCCACTAATAATATAACTCCATTATAGAACTCCCATTTGCCTTTTCTATGTTTTTTT
TTTCTTCTTCTAGCTTTTAGTTATTTAATAATAGAGATTCTTGTGTGTCATGCCACACTGATGATGCTCTCTCCATTTTTAAAATTTGACATCAC
TTGGAATCCTGAGTGTCTAGTAGATGATGATGATGGTGATAACGACAATGTCAACGATAACGAAGATGTCTCCATTGCTGAGCTTTGATTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E237707] SGN-U579436 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T53621 [Download][View] Facility Assigned ID: TOVCW68TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.920 Expected Error Rate: 0.0139 Quality Trim Threshold: 14.5