EST details — SGN-C172676

Search information 
Request: 172676Match: SGN-C172676
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C172676Clone name: TUS-14-C10
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172676 is on microarray TOM1 spot ID 1-1-7.3.20.5 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C10789 [cLEC-6-E20] Trace: SGN-T24119 EST: SGN-E202458 Direction: 5' Facility: TIGR
Clone: SGN-C172676 [TUS-14-C10] Trace: SGN-T195211 EST: SGN-E393885 Direction: 3' Facility: INRA
Clone: SGN-C172676 [TUS-14-C10] Trace: SGN-T195655 EST: SGN-E394329 Direction: 5' Facility: INRA
Clone: SGN-C172676 [TUS-14-C10] Trace: SGN-T195655 EST: SGN-E399537 Direction: 5' Facility: INRA
Clone: SGN-C172676 [TUS-14-C10] Trace: SGN-T195777 EST: SGN-E394451 Direction: 3' Facility: INRA
Clone: SGN-C172676 [TUS-14-C10] Trace: SGN-T195777 EST: SGN-E399029 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394037Length: 454 bp (851 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E394037 [] (trimmed) GGCGGATAAAATCCATGGTCTAACTGTTCCAGCTGATGGGCCACACCATGTACAAATTTTACATGAACCAATTGGGGTTGCTGGTCAAATAATTC
CATGGAACTTTCCCCTTCTGATGATGGCCTGGAAAGTTGGGCCTGCTTTAACGTGCGGTAACACTATTGTCCTGAAGACTGCAGAGCAAACTCCA
CTGACTGCTCTTTATGTTGCAAACTTACTCCATGAGGCTGGTCTTCCTCCAGGTGTTTTAAATATTGTTTCTGGTTTTGGACCTACCGCTGGTGC
TGCACTGGCTAGTCATATGGATGTAGACAAGCTTGCTTTCACTGGATCAACGGAAACTGGACAAACAGTTCTTCAACTGGCTGCCAAAAGCAATC
TGAAACCAGTTACCCTTGAACTATGAGGGAAAGGGGGGGTTCTTATATGTGAGGATGCTGACATTGATCATGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394037] SGN-U572014 Tomato 200607 Build 2 91 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195363 [Download][View] Facility Assigned ID: FA0AAD2BB05RM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0075 Quality Trim Threshold: 14.5