EST details — SGN-C16018

Search information 
Request: 16018Match: SGN-C16018
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C16018Clone name: cLED-14-O5
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C181523 is on microarray TOM1: SGN-S1-1-8.4.12.1
See unigene SGN-U579445 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C181523 [TUS-37-D1] Trace: SGN-T194038 EST: SGN-E392712 Direction: 3' Facility: INRA
Clone: SGN-C181523 [TUS-37-D1] Trace: SGN-T194039 EST: SGN-E392713 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E233636Length: 344 bp (711 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E233636 [] (trimmed) TTTTTTTTTAGAAGAAAAAAAAGTATCTATTTCATTGTTTATATAACTTAGTACAAAACTAAGATGTTTCTAATCCTCAATAATTATTGCATCTT
CTTCTGATGGGTACAAAACAATAAAAGAATCAATACAATAGTTTTTAAAGTAATACACTATTTTTTCATTATTAATGCTCAGATATTCTGAACAC
AATCTGCTGGAAATCCCTGTGGAAATCGCTTTGAATCAGTGCAGTAATCATAAACCATGTAATTCTTCTGCACCCATTTGAGCCTCTCTTGGCTT
GTGTTATCTAACTCTTCATTCAACCATGAATTGCTTGTTGAAGTTGCAGAAATGGAACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E233636] SGN-U579445 Tomato 200607 Build 2 169 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T51990 [Download][View] Facility Assigned ID: TOVCA87TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.909 Expected Error Rate: 0.0076 Quality Trim Threshold: 14.5