EST details — SGN-C15160

Search information 
Request: 15160Match: SGN-C15160
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C15160Clone name: cLED-11-B4
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175381 is on microarray TOM1: SGN-S1-1-6.4.13.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175381 [TUS-21-D3] Trace: SGN-T190577 EST: SGN-E377815 Direction: 3' Facility: INRA
Clone: SGN-C175381 [TUS-21-D3] Trace: SGN-T190578 EST: SGN-E377816 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E235547Length: 486 bp (786 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E235547 [] (trimmed) CATCTTCAACAGGTGAGAAGAGCTGATGAGCTGAAGATTTGTCAAGCATTTTGTACTGAAACTGTCAAACCGCCGGTAGAAGGTGAAAGTAATTC
CGGAAGAAATAGTCCTTTTGTCGCTTTTGTATTGGGAGGTCCTGGTAGTGGTAAAGGCACTCAATGCCTGAAGATTGCTGAAACTTTTGGGTTCG
ATCACATAGGTGCAGGAGATCTATTGAGGAAAGAGATGCATTCTGACTCCGAGAATGGTGCCATGATTCAAAAGTTAATGAAGGAAGGAAGTATT
GCTCCATCAGAGGTGACTGTCAAACTGATTAAAAAGGCAATTGAATCAGCTGAAAATCGTAAGTTTCTAATAGATGGTTTCCCAAGAAGTGAAGA
AAATAGAGTGGCGTATGAGAGGATTATTGGTGCTGAACCGAACTTTGTGCTTTTCTTTGATTGCCCTGAAGAAGTAATGGTCAAACGAGTATTGA
ACCGGAACGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E235547] SGN-U576655 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T51557 [Download][View] Facility Assigned ID: TOVBR02TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0039 Quality Trim Threshold: 14.5