EST details — SGN-C14384

Search information 
Request: 14384Match: SGN-C14384
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C14384Clone name: cLEC-7-L7
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172967 is on microarray TOM1: SGN-S1-1-4.3.20.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172967 [TUS-14-O13] Trace: SGN-T195609 EST: SGN-E394283 Direction: 5' Facility: INRA
Clone: SGN-C172967 [TUS-14-O13] Trace: SGN-T195609 EST: SGN-E398994 Direction: 5' Facility: INRA
Clone: SGN-C172967 [TUS-14-O13] Trace: SGN-T195765 EST: SGN-E394439 Direction: 3' Facility: INRA
Clone: SGN-C172967 [TUS-14-O13] Trace: SGN-T195765 EST: SGN-E399531 Direction: 3' Facility: INRA
Clone: SGN-C172967 [TUS-14-O13] Trace: SGN-T199441 EST: SGN-E398115 Direction: 3' Facility: INRA
Clone: SGN-C172967 [TUS-14-O13] Trace: SGN-T199544 EST: SGN-E398218 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202034Length: 439 bp (814 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202034 [] (trimmed) GTCAACTACTCTGTTAACACTATTCCTGTTTTTGTTCTTGAAATTTTTAATTATCAATGGTCATGGTGGAGCTGATGATGATGATGAACATGATT
CAAATGGAGATACAAATACAAATTTACGCGCGAAAGGATTGATTCTTGTTAAAATTTATTGCTTGATCATACTCTTTGTAACTACATTTGTTGGT
GGCGTATCGCCTTATTTCTATCGATGGAATGAGGGGTTTCTCTTGTTAGGAACTCAATTTGCTGGTGGTGTTTTCTTAGGGACTTCATTGATGCA
TTTTTTGAGTGATTCTGCTACAACTTTTGGTGTACTTACAGAAAAAGAGTACCCTTTTGCCTTCATGTTGGCTTCTGCAGGTTATCTTCTCACTA
TGTTTAGTGATTGCATTATTATGTTTGTGACAAAGGGGGGTGTAAATGAATCAAGTGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202034] SGN-U567009 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25316 [Download][View] Facility Assigned ID: TCABA64TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.934 Expected Error Rate: 0.0040 Quality Trim Threshold: 14.5