EST details — SGN-C14358

Search information 
Request: 14358Match: SGN-C14358
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C14358Clone name: cLEC-7-K24
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172954 is on microarray TOM1: SGN-S1-1-1.2.20.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172954 [TUS-14-N24] Trace: SGN-T188125 EST: SGN-E374817 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E201991Length: 459 bp (748 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E201991 [] (trimmed) GATTTATGCAGTAGATGATGAGCAATATCCCAAAATCTCTAACAGATTCTTCTTTTACTCTCTTCAAACTTGCCATCTCGGCTTCTGATCCTTGG
CCTTTCTCTACTGTTTTCTTATAACAGCCTCTTTCTCCCTATACATATACTCTGTTTGTTTGTTTTTTCGAACACAAAAAAAAAAAAAAAAGAAT
GGGTCATAATCATCATTTGAATTTCCATTTTCACGTCCCTCACATCCATTTTCATCATCATCACGGAAAAAGAGAATTGAGGAACGTACCAAAAG
GATGTTTGGCAATAACAGTAGGACAAGGTGAAGAGCAACAGACGTTTGTGATCCCAGTGATATACATAAATCATCCCCTGTTTATGCAGCTGTTG
AAAGAATCAGAAGATGAATATGGATTCGATCATAATGGACCTATTAATATCCCTTGTCATGTCGAAGAATTTCGACATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E201991] SGN-U572472 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25273 [Download][View] Facility Assigned ID: TCAAZ72TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0108 Quality Trim Threshold: 14.5