Notice: the solgenomics has been unstable, we apologize for the inconvenience.

EST details — SGN-C11026

Search information 
Request: 11026Match: SGN-C11026
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C11026Clone name: cLEC-6-P12
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172840 is on microarray TOM1: SGN-S1-1-3.2.20.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172840 [TUS-14-J6] Trace: SGN-T188099 EST: SGN-E374791 Direction: 3' Facility: INRA
Clone: SGN-C172840 [TUS-14-J6] Trace: SGN-T188100 EST: SGN-E374792 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202576Length: 590 bp (762 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202576 [] (trimmed) ATTCCCTGTGGCACCAACTTCTCCAAGAATCAATTCACCTAGAGATGCGTCTCCTCAGAGTTCTTATAGGGCTACATCTCCTGGTGTCACTTCTC
CGAGGGTCGCCTCTCCAAGGGTTGTCTCTCCTAAGGCAGCTTCTCCAAAGGTTACCTCTCCCAAGGAAGCTTCTCCGAAGGTTACATCTCCCAGG
GAAGCTTATCCAAAGGCTACCTCTGCTAGTGCTCCTTCCCTAAAGGCTCTCTCTCCTAGGGAAGCTTCTCCAAAGGCGAACTCTGCTAGTGCTCC
TTCCCAGAAGGCTACTGCTCCCAAGGAGGCTTCTCCAAGGGTCTCTTCCCCTAGATCTACTTATCCAGAGCCGAGTAGGAACCATAATGAGATTA
GCTATGCTAACAGGCCAGAAGCAACTTTGACGCTCCATCTTTCAGCAACCAAGATACAGGCAGCCTACAGAAGTTACATGGCAAGGAGGGGTTTC
AAATCTTTGAGTGGTTTAGCAAGACTTCAAGGAGTGGTCAGAAGCAGAAGTGTAAAGCGGCAGACAGTAAATGCCATGAAACAAATGCAACTTCT
AGGTAGGGTTCAAATGCAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202576] SGN-U581234 Tomato 200607 Build 2 53 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T24237 [Download][View] Facility Assigned ID: TCAAX90TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0093 Quality Trim Threshold: 14.5