EST details — SGN-E208201

Search information 
Request: 208201Match: SGN-E208201
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C6881Clone name: cLEC-37-C18
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C174059 is on microarray TOM1: SGN-S1-1-8.1.17.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174059 [TUS-17-M1] Trace: SGN-T191654 EST: SGN-E390328 Direction: 3' Facility: INRA
Clone: SGN-C174059 [TUS-17-M1] Trace: SGN-T197468 EST: SGN-E396142 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E208201Length: 455 bp (908 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E208201 [] (trimmed) CTCAGCAAGAGAGCTTCTGGATGACCCTTTTCTCCGGACTGATGATAGTGAATCAGATTTAAGACATACAGAGTCTAGGAGAGAACTAGATTATA
TGAACCCTCTGCTAAGGAAGCCTGTCATCGCACTAGATTATGAAGGAAAATCATTTGGTAATGGCACCTACAATGATTATGGTTTTGATGATATA
CATGAATGGGCATCTGATCCAAATGAATACGAGCAAACTGGAATTGAACTGTTTGAGTATAACGATGATGAACACGATGAACATTCCGCAGATTT
GGATATAACTATTAAAGGGAAGAGAAAAGAAGATGGAAGCATCTTCTTAAGACTCAGAATTGCAGACAAAGAAGGCCGTATCAGGAACATCTATT
TCCCATTTGATGTTGAATATGATACAGCATTAACTGTTGCAACTGAAATGGTATCCGAATTGGATATAACTGATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E208201] SGN-U574016 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T31192 [Download][View] Facility Assigned ID: TCAFP21TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0126 Quality Trim Threshold: 14.5