EST details — SGN-E201987

Search information 
Request: 201987Match: SGN-E201987
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C14362Clone name: cLEC-7-K6
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172957 is on microarray TOM1: SGN-S1-1-6.3.20.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172957 [TUS-14-O3] Trace: SGN-T195151 EST: SGN-E393825 Direction: 3' Facility: INRA
Clone: SGN-C172957 [TUS-14-O3] Trace: SGN-T195327 EST: SGN-E394001 Direction: 3' Facility: INRA
Clone: SGN-C172957 [TUS-14-O3] Trace: SGN-T195327 EST: SGN-E398988 Direction: 3' Facility: INRA
Clone: SGN-C172957 [TUS-14-O3] Trace: SGN-T195328 EST: SGN-E394002 Direction: 5' Facility: INRA
Clone: SGN-C172957 [TUS-14-O3] Trace: SGN-T195606 EST: SGN-E394280 Direction: 5' Facility: INRA
Clone: SGN-C172957 [TUS-14-O3] Trace: SGN-T195606 EST: SGN-E398989 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E201987Length: 494 bp (748 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E201987 [] (trimmed) GCAAGATGTTTATGTTTTACGGTTCATTCTGCTAGTAATCTCATAAATGTTCGAAAATTTGGAGAAATGAAAGTTTATGCAAAGGTTTCAATAGC
AGGAAAGAGTGAGTGTACAGAACCGGATCTTGTGAAAAGCATAAATCCTGAGTGGAACAAGATGTTTACGTTCATCGTGCCAGAATACAATATCA
TACAAGCACAAGGTAAAATTTATGTTAAAATCGAATTGATTTGTAAGAGGAGTTTGTCGCGCGATAAATATGTTGGTGAAGTAAACCTTAGTCTA
GATTCTCAAAGTCCAAGATCATGTAACACTTGTGTAGTGGATAGGAGTGGTTCAAATTTTGGGACTTTGATGTATTCAAGTGTGCTAAGTGATAA
ATTAATAGTTATGGACTCATCACCATCAAAGGATTACAATAACAAAGTTAATATAGCTCAAATTGCAGCTACTTTAGTAGGTGCAGTGGCTACAG
GGGCTGCCGCGTTCGCGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E201987] SGN-U585669 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25269 [Download][View] Facility Assigned ID: TCAAZ63TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0031 Quality Trim Threshold: 14.5