<?xml version="1.0" encoding="ISO-8859-1"?>
<GTH_output xmlns="http://www.genomethreader.org/GTH_output/" GTH_XML_version="1.1">
  <header xmlns="http://www.genomethreader.org/GTH_output/header/">
    <source program="GenomeThreader" version="0.9.54" build_date="2006-07-28 11:55:15" run_date="2009-01-15 12:58:39"/>
    <gDNA_template_files>
      <temp_name>/tmp/bac-submission-temp-C09HBa0226D21-dSMcV/GenomeThreader_SGN_markers/un_xed_seqs</temp_name>
    </gDNA_template_files>
    <reference_files>
      <file ref_name="/tmp/bac-submission-temp-C09HBa0226D21-dSMcV/gth_cdna_fileCXGN::BACSubmission::Analysis::GenomeThreader_SGN_markers" type="ESTcDNA"/>
    </reference_files>
    <splice_site_parameters parameter_type="Bayesian" species="arabidopsis"/>
    <parameters>
      <parameter name="bssmfile" value="arabidopsis"/>
      <parameter name="scorematrixfile" value="BLOSUM62"/>
      <parameter name="searchmode" value="forward=True,reverse=True)"/>
      <parameter name="translationtable" value="1"/>
      <parameter name="frompos" value="0"/>
      <parameter name="topos" value="0"/>
      <parameter name="width" value="0"/>
      <parameter name="verbose" value="False"/>
      <parameter name="skipalignmentout" value="False"/>
      <parameter name="showintronmaxlen" value="120"/>
      <parameter name="minorflen" value="64"/>
      <parameter name="showseqnums" value="False"/>
      <parameter name="gs2out" value="False"/>
      <parameter name="maskpolyatails" value="False"/>
      <parameter name="noautoindex" value="False"/>
      <parameter name="minmatchlen" value="20"/>
      <parameter name="seedlength" value="16"/>
      <parameter name="exdrop" value="2"/>
      <parameter name="online" value="False"/>
      <parameter name="inverse" value="False"/>
      <parameter name="exact" value="False"/>
      <parameter name="chainwf" value="0.500000"/>
      <parameter name="gcmaxgapwidth" value="1000000"/>
      <parameter name="gcmincoverage" value="50"/>
      <parameter name="introncutout" value="False"/>
      <parameter name="autointroncutout" value="0"/>
      <parameter name="icinitialdelta" value="50"/>
      <parameter name="iciterations" value="2"/>
      <parameter name="icdeltaincrease" value="50"/>
      <parameter name="icminremintronlen" value="10"/>
      <parameter name="nou12intronmodel" value="False"/>
      <parameter name="u12donorprob" value="0.990000"/>
      <parameter name="u12donorprob1mism" value="0.900000"/>
      <parameter name="probies" value="0.500000"/>
      <parameter name="probdelgen" value="0.030000"/>
      <parameter name="identityweight" value="2.000000"/>
      <parameter name="mismatchweight" value="-2.000000"/>
      <parameter name="undetcharweight" value="0.000000"/>
      <parameter name="deletionweight" value="-4.000000"/>
      <parameter name="dpminexonlen" value="5"/>
      <parameter name="dpminintronlen" value="50"/>
      <parameter name="shortexonpenal" value="100"/>
      <parameter name="shortintronpenal" value="100"/>
      <parameter name="wzerotransition" value="80"/>
      <parameter name="wdecreasedoutput" value="80"/>
      <parameter name="leadcutoffsmode" value="RELAXED"/>
      <parameter name="termcutoffsmode" value="STRICT"/>
      <parameter name="cutoffsminexonlen" value="5"/>
      <parameter name="scoreminexonlen" value="50"/>
      <parameter name="minaveragessp" value="0.500000"/>
      <parameter name="minalignmentscore" value="0.900000"/>
      <parameter name="maxalignmentscore" value="1.000000"/>
      <parameter name="mincoverage" value="0.900000"/>
      <parameter name="maxcoverage" value="100.000000"/>
      <parameter name="intermediate" value="False"/>
      <parameter name="sortags" value="False"/>
      <parameter name="sortagswf" value="1.000000"/>
      <parameter name="first" value="0"/>
      <parameter name="exondistri" value="False"/>
      <parameter name="introndistri" value="False"/>
      <parameter name="refseqcovdistri" value="False"/>
    </parameters>
    <overall_reference_type>ESTcDNA</overall_reference_type>
  </header>
  <alignment_module>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/bac-submission-temp-C09HBa0226D21-dSMcV/gth_cdna_fileCXGN::BACSubmission::Analysis::GenomeThreader_SGN_markers" ref_id="SGN-M1440" ref_strand="+" ref_description="SGN-M1440 T0486 [cos_markers]">
      <seq>aatgacgaaagagggaaagaatgtgaaaagaatcaaattgggttcagagggacttgaagtatctgttcaaggacttggttgtctgggtatgtccgatttctacggtccgcccaaacccgaacccgatatgattgaactaatacaccatgccattaactccggcataacatttttcgatacttcaaatagttatgggccttacactaatgaaatcctccttggcaaggctttgaagggaggaatgagggaacgagtcgagttagcaacaaaatttggtatacattttgcagatggaaagatagaagtacgtggagagccataatatgtaagggcagcatgcgaggctagcttaaagcgacttgatgttgattgcatagacttgtactacc</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C09HBa0226D21-dSMcV/GenomeThreader_SGN_markers/un_xed_seqs" temp_id="C09HBa0226D21.1" temp_strand="-" temp_description="C09HBa0226D21.1  EU139072.1 htgs_phase:3 submitted_to_sgn_as:C09HBa0226D21 upload_account_name:spain">
        <position start="111988" stop="110902"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="111688" g_stop="111463" g_length="226"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="226" r_length="226" r_score="1.000"/>
        </exon>
        <intron i_serial="1">
          <gDNA_intron_boundary i_start="111462" i_stop="111365" i_length="98">
            <donor d_prob="0.995" d_score="1.00"/>
            <acceptor a_prob="0.987" a_score="1.00"/>
          </gDNA_intron_boundary>
        </intron>
        <exon e_serial="2">
          <gDNA_exon_boundary g_start="111364" g_stop="111202" g_length="163"/>
          <reference_exon_boundary r_type="cDNA" r_start="227" r_stop="389" r_length="163" r_score="0.994"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C09HBa0226D21.1" gen_strand="-" ref_id="SGN-M1440" ref_strand="+">
        <total_alignment_score>0.997</total_alignment_score>
        <cumulative_length_of_scored_exons>389</cumulative_length_of_scored_exons>
        <coverage percentage="1.000" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C09HBa0226D21.1" gen_strand="-"/>
        <rDNA rDNA_id="SGN-M1440" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="111688" e_stop="111463"/>
          <exon e_start="111364" e_stop="111202"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>AATGACGAAAGAGGGAAAGAATGTGAAAAGAATCAAATTGGGTTCAGAGGGACTTGAAGTATCTGTTCAAGGACTTGGTTGTCTGGGTATGTCCGATTTCTACGGTCCGCCCAAACCCGAACCCGATATGATTGAACTAATACACCATGCCATTAACTCCGGCATAACATTTTTCGATACTTCAAATAGTTATGGGCCTTACACTAATGAAATCCTCCTTGGCAAGGTATCAATTTGTCAATTCTTTTAAGTTATGGTTGTACCGAATCGAACATGAAGTAATAAGGTGAAAGTAAATACTGAGCTGCTAAAATTCTAATACAGGCTTTGAAGGGAGGAATGAGGGAACGAGTCGAGTTAGCAACAAAATTTGGTATACATTTTGCAGATGGAAAGATAGAAGTACGTGGAGAGCCAGAATATGTAAGGGCAGCATGCGAGGCTAGCTTAAAGCGACTTGATGTTGATTGCATAGACTTGTACTACC</genome_strand>
        <mrna_strand>AATGACGAAAGAGGGAAAGAATGTGAAAAGAATCAAATTGGGTTCAGAGGGACTTGAAGTATCTGTTCAAGGACTTGGTTGTCTGGGTATGTCCGATTTCTACGGTCCGCCCAAACCCGAACCCGATATGATTGAACTAATACACCATGCCATTAACTCCGGCATAACATTTTTCGATACTTCAAATAGTTATGGGCCTTACACTAATGAAATCCTCCTTGGCAAG..................................................................................................GCTTTGAAGGGAGGAATGAGGGAACGAGTCGAGTTAGCAACAAAATTTGGTATACATTTTGCAGATGGAAAGATAGAAGTACGTGGAGAGCCATAATATGTAAGGGCAGCATGCGAGGCTAGCTTAAAGCGACTTGATGTTGATTGCATAGACTTGTACTACC</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
    <total_number_ESTs_reported>1</total_number_ESTs_reported>
    </alignment_module>
  <PGL_module xmlns="http://www.genomethreader.org/GTH_output/PGL_module/">
    <predicted_gene_location>
      <PGL_line PGL_serial="1" PGL_strand="-" PGL_start="111688" PGL_stop="111202"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="111688" e_stop="111463"/>
            <exon e_start="111364" e_stop="111202"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-intron don_prob="0.995" acc_prob="0.987" e_score="1.000"/>
          <exon-only e_score="0.994"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="1.000">
            <gDNA_exon_boundary e_start="111688" e_stop="111463" e_length="226"/>
          </exon>
          <intron i_serial="1" don_prob="0.995" acc_prob="0.987">
            <gDNA_intron_boundary i_start="111462" i_stop="111365" i_length="98"/>
          </intron>
          <exon e_serial="2" e_score="0.994">
            <gDNA_exon_boundary e_start="111364" e_stop="111202" e_length="163"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="111688" stop="111463"/>
              <exon start="111364" stop="111202"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-M1440" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="1" AGS_serial="1" gDNA_strand="-"/>
          <translation>
            <gDNA_template>AATGACGAAAGAGGGAAAGAATGTGAAAAGAATCAAATTGGGTTCAGAGGGACTTGAAGTATCTGTTCAAGGACTTGGTTGTCTGGGTATGTCCGATTTCTACGGTCCGCCCAAACCCGAACCCGATATGATTGAACTAATACACCATGCCATTAACTCCGGCATAACATTTTTCGATACTTCAAATAGTTATGGGCCTTACACTAATGAAATCCTCCTTGGCAAG : GCTTTGAAGGGAGGAATGAGGGAACGAGTCGAGTTAGCAACAAAATTTGGTATACATTTTGCAGATGGAAAGATAGAAGTACGTGGAGAGCCAGAATATGTAAGGGCAGCATGCGAGGCTAGCTTAAAGCGACTTGATGTTGATTGCATAGACTTGTACTACC</gDNA_template>
            <first_frame> N  D  E  R  G  K  E  C  E  K  N  Q  I  G  F  R  G  T  *  S  I  C  S  R  T  W  L  S  G  Y  V  R  F  L  R  S  A  Q  T  R  T  R  Y  D  *  T  N  T  P  C  H  *  L  R  H  N  I  F  R  Y  F  K  *  L  W  A  L  H  *  *  N  P  P  W  Q   : G  F  E  G  R  N  E  G  T  S  R  V  S  N  K  I  W  Y  T  F  C  R  W  K  D  R  S  T  W  R  A  R  I  C  K  G  S  M  R  G  *  L  K  A  T  *  C  *  L  H  R  L  V  L   </first_frame>
            <second_frame>  M  T  K  E  G  K  N  V  K  R  I  K  L  G  S  E  G  L  E  V  S  V  Q  G  L  G  C  L  G  M  S  D  F  Y  G  P  P  K  P  E  P  D  M  I  E  L  I  H  H  A  I  N  S  G  I  T  F  F  D  T  S  N  S  Y  G  P  Y  T  N  E  I  L  L  G  K  :  A  L  K  G  G  M  R  E  R  V  E  L  A  T  K  F  G  I  H  F  A  D  G  K  I  E  V  R  G  E  P  E  Y  V  R  A  A  C  E  A  S  L  K  R  L  D  V  D  C  I  D  L  Y  Y  </second_frame>
            <third_frame>   *  R  K  R  E  R  M  *  K  E  S  N  W  V  Q  R  D  L  K  Y  L  F  K  D  L  V  V  W  V  C  P  I  S  T  V  R  P  N  P  N  P  I  *  L  N  *  Y  T  M  P  L  T  P  A  *  H  F  S  I  L  Q  I  V  M  G  L  T  L  M  K  S  S  L  A  R :   L  *  R  E  E  *  G  N  E  S  S  *  Q  Q  N  L  V  Y  I  L  Q  M  E  R  *  K  Y  V  E  S  Q  N  M  *  G  Q  H  A  R  L  A  *  S  D  L  M  L  I  A  *  T  C  T  T </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <orf_entry>
              <id_line>
                <gDNA id="C09HBa0226D21.1" strand="-"/>
                <serials PGL_serial="1" AGS_serial="1" PPS_serial="1"/>
                <orf_info>
                  <exon_boundaries>
                    <exon start="111687" stop="111463"/>
                    <exon start="111364" stop="111203"/>
                  </exon_boundaries>
                  <frame>1</frame>
                  <number_coding_nucleotides>387</number_coding_nucleotides>
                  <number_encoded_amino_acids>129</number_encoded_amino_acids>
                </orf_info>
              </id_line>
              <predicted_protein_sequence>MTKEGKNVKRIKLGSEGLEVSVQGLGCLGMSDFYGPPKPEPDMIELIHHAINSGITFFDTSNSYGPYTNEILLGKALKGGMRERVELATKFGIHFADGKIEVRGEPEYVRAACEASLKRLDVDCIDLYY</predicted_protein_sequence>
            </orf_entry>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
  </PGL_module>
</GTH_output>
<!--
$ general statistics:
$ 19 chains have been computed
$ 
$ memory statistics:
$ 2280 bytes spliced alignments in total
$ 1 spliced alignments have been stored
$ 2280 bytes was the average size of a spliced alignment
$ 5560 bytes predicted gene locations in total
$ 1 predicted gene locations have been stored
$ 5560 bytes was the average size of a predicted gene location
$ 0 megabytes was the average size of the backtrace matrix
$ 19 backtrace matrices have been allocated
$ 
$ date finished: 2009-01-15 12:58:42
-->
