<?xml version="1.0" encoding="ISO-8859-1"?>
<GTH_output xmlns="http://www.genomethreader.org/GTH_output/" GTH_XML_version="1.1">
  <header xmlns="http://www.genomethreader.org/GTH_output/header/">
    <source program="GenomeThreader" version="0.9.54" build_date="2006-07-28 11:55:15" run_date="2009-01-15 12:56:10"/>
    <gDNA_template_files>
      <temp_name>/tmp/bac-submission-temp-C09HBa0165P17-E2tIK/GenomeThreader_SGN_markers/un_xed_seqs</temp_name>
    </gDNA_template_files>
    <reference_files>
      <file ref_name="/tmp/bac-submission-temp-C09HBa0165P17-E2tIK/gth_cdna_fileCXGN::BACSubmission::Analysis::GenomeThreader_SGN_markers" type="ESTcDNA"/>
    </reference_files>
    <splice_site_parameters parameter_type="Bayesian" species="arabidopsis"/>
    <parameters>
      <parameter name="bssmfile" value="arabidopsis"/>
      <parameter name="scorematrixfile" value="BLOSUM62"/>
      <parameter name="searchmode" value="forward=True,reverse=True)"/>
      <parameter name="translationtable" value="1"/>
      <parameter name="frompos" value="0"/>
      <parameter name="topos" value="0"/>
      <parameter name="width" value="0"/>
      <parameter name="verbose" value="False"/>
      <parameter name="skipalignmentout" value="False"/>
      <parameter name="showintronmaxlen" value="120"/>
      <parameter name="minorflen" value="64"/>
      <parameter name="showseqnums" value="False"/>
      <parameter name="gs2out" value="False"/>
      <parameter name="maskpolyatails" value="False"/>
      <parameter name="noautoindex" value="False"/>
      <parameter name="minmatchlen" value="20"/>
      <parameter name="seedlength" value="16"/>
      <parameter name="exdrop" value="2"/>
      <parameter name="online" value="False"/>
      <parameter name="inverse" value="False"/>
      <parameter name="exact" value="False"/>
      <parameter name="chainwf" value="0.500000"/>
      <parameter name="gcmaxgapwidth" value="1000000"/>
      <parameter name="gcmincoverage" value="50"/>
      <parameter name="introncutout" value="False"/>
      <parameter name="autointroncutout" value="0"/>
      <parameter name="icinitialdelta" value="50"/>
      <parameter name="iciterations" value="2"/>
      <parameter name="icdeltaincrease" value="50"/>
      <parameter name="icminremintronlen" value="10"/>
      <parameter name="nou12intronmodel" value="False"/>
      <parameter name="u12donorprob" value="0.990000"/>
      <parameter name="u12donorprob1mism" value="0.900000"/>
      <parameter name="probies" value="0.500000"/>
      <parameter name="probdelgen" value="0.030000"/>
      <parameter name="identityweight" value="2.000000"/>
      <parameter name="mismatchweight" value="-2.000000"/>
      <parameter name="undetcharweight" value="0.000000"/>
      <parameter name="deletionweight" value="-4.000000"/>
      <parameter name="dpminexonlen" value="5"/>
      <parameter name="dpminintronlen" value="50"/>
      <parameter name="shortexonpenal" value="100"/>
      <parameter name="shortintronpenal" value="100"/>
      <parameter name="wzerotransition" value="80"/>
      <parameter name="wdecreasedoutput" value="80"/>
      <parameter name="leadcutoffsmode" value="RELAXED"/>
      <parameter name="termcutoffsmode" value="STRICT"/>
      <parameter name="cutoffsminexonlen" value="5"/>
      <parameter name="scoreminexonlen" value="50"/>
      <parameter name="minaveragessp" value="0.500000"/>
      <parameter name="minalignmentscore" value="0.900000"/>
      <parameter name="maxalignmentscore" value="1.000000"/>
      <parameter name="mincoverage" value="0.900000"/>
      <parameter name="maxcoverage" value="100.000000"/>
      <parameter name="intermediate" value="False"/>
      <parameter name="sortags" value="False"/>
      <parameter name="sortagswf" value="1.000000"/>
      <parameter name="first" value="0"/>
      <parameter name="exondistri" value="False"/>
      <parameter name="introndistri" value="False"/>
      <parameter name="refseqcovdistri" value="False"/>
    </parameters>
    <overall_reference_type>ESTcDNA</overall_reference_type>
  </header>
  <alignment_module>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/bac-submission-temp-C09HBa0165P17-E2tIK/gth_cdna_fileCXGN::BACSubmission::Analysis::GenomeThreader_SGN_markers" ref_id="SGN-M462-F" ref_strand="+" ref_description="SGN-M462-F TG591-F [rflp_markers_forward]">
      <seq>taaatctgttgaaatagctgcaaatctactcgtgcaagaaggtacgcgtttacattggttgagggaggacatctagagaaatgagacacattcgatcgtatgtatacgatgcaaaggcaaaggaagttggaggtcaaaaacctattacaagatattcaacaactggcaggtgatgtggaggatctattagatgagttccttccaaaaattcaacaatccaataaggtcatttgatgccttaagactgtttcttttgcggataagtttgctatggagattgagaacataaaaagaagagttgctgatattgaccgtgtaaggacaacttaccacatcacggatactagtaacaataatgatgattgcattccaatggaccagagaagacgattccttcatgctaatgatgaaacagaggtcatcggattggatcatgacttcaacaagctccaacacaaattgcttcttcaagatttgccttacggagttgtttca</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C09HBa0165P17-E2tIK/GenomeThreader_SGN_markers/un_xed_seqs" temp_id="C09HBa0165P17.1" temp_strand="-" temp_description="C09HBa0165P17.1  EF647605.1 htgs_phase:3 submitted_to_sgn_as:C09HBa0165P17 upload_account_name:spain">
        <position start="81281" stop="69279"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="70095" g_stop="69579" g_length="517"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="495" r_length="495" r_score="0.923"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C09HBa0165P17.1" gen_strand="-" ref_id="SGN-M462-F" ref_strand="+">
        <total_alignment_score>0.923</total_alignment_score>
        <cumulative_length_of_scored_exons>517</cumulative_length_of_scored_exons>
        <coverage percentage="1.044" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C09HBa0165P17.1" gen_strand="-"/>
        <rDNA rDNA_id="SGN-M462-F" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="70095" e_stop="69579"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>TAAATCTGTTGAAATAGCTGCAAATCTACTCGTGCAAGAAGGTACGCGTTTATATTGGTTGAAGGAGGACATCGATTGGCTCCAAAGAGAAATGAAACACATTCGATCATATGTAGACGATGCAAAGGCAAAGGAAGTTGGAGGTGATTCAAGGGTCAAAAACCTATTAGAAGATATTCAACAACTGGCAGGTGATGTGGAGGATCTATTAGATGAGTTCCTTCCAAAAATTCAACAATCCAATAAGTTCATTTGTTGCCTTAAGACTGTTTATTTTGCGAATAAGTTTGCTATGGAGATTGAGAAGATAAAAAGAAGAGTTGCTGATATTGACCGTGTAAGGACAACTTACAACATCACAGATACAAGTAACAATAATGATGATTGCATTCCAATGGACCGGAGAAGACGATTCCTTCATGCTTATGATGAAACAGAGGTCATCGGTTTGGATCATGACTTCAACAAGCTCCAACACAAATTGCTTCTTCAAGATTTGCCTTATGGAGTTGTTTCA</genome_strand>
        <mrna_strand>TAAATCTGTTGAAATAGCTGCAAATCTACTCGTGCAAGAAGGTACGCGTTTACATTGGTTGAGGGAGG--A-C-A-T--CT----AGAGAAATGAGACACATTCGATCGTATGTATACGATGCAAAGGCAAAGGAAGTT----G-G-----A-GGTCAAAAACCTATTACAAGATATTCAACAACTGGCAGGTGATGTGGAGGATCTATTAGATGAGTTCCTTCCAAAAATTCAACAATCCAATAAGGTCATTTGATGCCTTAAGACTGTTTCTTTTGCGGATAAGTTTGCTATGGAGATTGAGAACATAAAAAGAAGAGTTGCTGATATTGACCGTGTAAGGACAACTTACCACATCACGGATACTAGTAACAATAATGATGATTGCATTCCAATGGACCAGAGAAGACGATTCCTTCATGCTAATGATGAAACAGAGGTCATCGGATTGGATCATGACTTCAACAAGCTCCAACACAAATTGCTTCTTCAAGATTTGCCTTACGGAGTTGTTTCA</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/bac-submission-temp-C09HBa0165P17-E2tIK/gth_cdna_fileCXGN::BACSubmission::Analysis::GenomeThreader_SGN_markers" ref_id="SGN-M462-R" ref_strand="+" ref_description="SGN-M462-R TG591-R [rflp_markers_reverse]">
      <seq>ggagacagcttgcatgcctgcagtcaccacaatcgctagcggtatacctccacatctctcaactatacatctaccaatatttaccaagtctggtgaagtattggcccaattatcatcaacaaaattacagattttcttggtaaagagttcaaaactgttctctgagtctagaggttgcaactcgtggattgagaaatcccctcctatgtatctgcctacattactatttcgagaggttataattatcctactgccaatttttgaatacgattcaggaaggacgagttttagatcatcccaaatttcaacatcccaaatgtcatctaaaaggataacgtacctttttattttcaagagtgatcttaggttgtgttccaagttctctttcctttcttcttccgtcagtccaacttgtttggctatgttaagcaagatttctcccgcccttggctgctgcgagacatagaccaatccagaacattcaaattgatgacggacgtgcctataaagtttcttggcaagagtagtttttcccaaaccggg</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C09HBa0165P17-E2tIK/GenomeThreader_SGN_markers/un_xed_seqs" temp_id="C09HBa0165P17.1" temp_strand="+" temp_description="C09HBa0165P17.1  EF647605.1 htgs_phase:3 submitted_to_sgn_as:C09HBa0165P17 upload_account_name:spain">
        <position start="79622" stop="80752"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="79923" g_stop="80451" g_length="529"/>
          <reference_exon_boundary r_type="cDNA" r_start="14" r_stop="542" r_length="529" r_score="0.989"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C09HBa0165P17.1" gen_strand="+" ref_id="SGN-M462-R" ref_strand="+">
        <total_alignment_score>0.989</total_alignment_score>
        <cumulative_length_of_scored_exons>529</cumulative_length_of_scored_exons>
        <coverage percentage="0.974" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C09HBa0165P17.1" gen_strand="+"/>
        <rDNA rDNA_id="SGN-M462-R" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="79923" e_stop="80451"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>ATACCTGCAGTCACCACAATCGCTAGCGGTATACCTCCACATCTCTCAACTATACATCTACCAATATTTACCAAGTCTGGTGAAGTATTGGCCCAATTATCATCAACAAAATTACAGATTTTCTTGGTAAAGAGTTCAAAACTGTTCTCCGAATCTAGAGGTTGCAACACGTGGATTGAGAAATCCCCTCCTATGTATCTGCCTACATTACTATTTCGAGAGGTTATAATTATCCTACTGCCAATTTTTGAATCAGATTCAGGAAGGACGAGTTTTAGATCATCCCAAATTTCAACATCCCAAATGTCATCTAAAAGGATAACGTACCTTTTTATTTTCAAGAGTGATCTTAGGTTGTGTTCCAAGTTCTCTTTCCTTTCTTCTTCCGTCAGTCCAACTTGTTTGGCTATGTTAAGCAAGATTTCTCCCGCCCTTGGCTGCTGCGAGACATAGACCAATCCAGAACATTCAAATTGATGACGGACGTGCCTATAAAGTTTCTTGGCAAGAGTAGTTTTTCCCAAACCGG</genome_strand>
        <mrna_strand>ATGCCTGCAGTCACCACAATCGCTAGCGGTATACCTCCACATCTCTCAACTATACATCTACCAATATTTACCAAGTCTGGTGAAGTATTGGCCCAATTATCATCAACAAAATTACAGATTTTCTTGGTAAAGAGTTCAAAACTGTTCTCTGAGTCTAGAGGTTGCAACTCGTGGATTGAGAAATCCCCTCCTATGTATCTGCCTACATTACTATTTCGAGAGGTTATAATTATCCTACTGCCAATTTTTGAATACGATTCAGGAAGGACGAGTTTTAGATCATCCCAAATTTCAACATCCCAAATGTCATCTAAAAGGATAACGTACCTTTTTATTTTCAAGAGTGATCTTAGGTTGTGTTCCAAGTTCTCTTTCCTTTCTTCTTCCGTCAGTCCAACTTGTTTGGCTATGTTAAGCAAGATTTCTCCCGCCCTTGGCTGCTGCGAGACATAGACCAATCCAGAACATTCAAATTGATGACGGACGTGCCTATAAAGTTTCTTGGCAAGAGTAGTTTTTCCCAAACCGG</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
    <total_number_ESTs_reported>2</total_number_ESTs_reported>
    </alignment_module>
  <PGL_module xmlns="http://www.genomethreader.org/GTH_output/PGL_module/">
    <predicted_gene_location>
      <PGL_line PGL_serial="1" PGL_strand="-" PGL_start="70095" PGL_stop="69579"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="70095" e_stop="69579"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-only e_score="0.923"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="0.923">
            <gDNA_exon_boundary e_start="70095" e_stop="69579" e_length="517"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="70095" stop="69579"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-M462-F" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="1" AGS_serial="1" gDNA_strand="-"/>
          <translation>
            <gDNA_template>TAAATCTGTTGAAATAGCTGCAAATCTACTCGTGCAAGAAGGTACGCGTTTATATTGGTTGAAGGAGGACATCGATTGGCTCCAAAGAGAAATGAAACACATTCGATCATATGTAGACGATGCAAAGGCAAAGGAAGTTGGAGGTGATTCAAGGGTCAAAAACCTATTAGAAGATATTCAACAACTGGCAGGTGATGTGGAGGATCTATTAGATGAGTTCCTTCCAAAAATTCAACAATCCAATAAGTTCATTTGTTGCCTTAAGACTGTTTATTTTGCGAATAAGTTTGCTATGGAGATTGAGAAGATAAAAAGAAGAGTTGCTGATATTGACCGTGTAAGGACAACTTACAACATCACAGATACAAGTAACAATAATGATGATTGCATTCCAATGGACCGGAGAAGACGATTCCTTCATGCTTATGATGAAACAGAGGTCATCGGTTTGGATCATGACTTCAACAAGCTCCAACACAAATTGCTTCTTCAAGATTTGCCTTATGGAGTTGTTTCA</gDNA_template>
            <first_frame> *  I  C  *  N  S  C  K  S  T  R  A  R  R  Y  A  F  I  L  V  E  G  G  H  R  L  A  P  K  R  N  E  T  H  S  I  I  C  R  R  C  K  G  K  G  S  W  R  *  F  K  G  Q  K  P  I  R  R  Y  S  T  T  G  R  *  C  G  G  S  I  R  *  V  P  S  K  N  S  T  I  Q  *  V  H  L  L  P  *  D  C  L  F  C  E  *  V  C  Y  G  D  *  E  D  K  K  K  S  C  *  Y  *  P  C  K  D  N  L  Q  H  H  R  Y  K  *  Q  *  *  *  L  H  S  N  G  P  E  K  T  I  P  S  C  L  *  *  N  R  G  H  R  F  G  S  *  L  Q  Q  A  P  T  Q  I  A  S  S  R  F  A  L  W  S  C  F  </first_frame>
            <second_frame>  K  S  V  E  I  A  A  N  L  L  V  Q  E  G  T  R  L  Y  W  L  K  E  D  I  D  W  L  Q  R  E  M  K  H  I  R  S  Y  V  D  D  A  K  A  K  E  V  G  G  D  S  R  V  K  N  L  L  E  D  I  Q  Q  L  A  G  D  V  E  D  L  L  D  E  F  L  P  K  I  Q  Q  S  N  K  F  I  C  C  L  K  T  V  Y  F  A  N  K  F  A  M  E  I  E  K  I  K  R  R  V  A  D  I  D  R  V  R  T  T  Y  N  I  T  D  T  S  N  N  N  D  D  C  I  P  M  D  R  R  R  R  F  L  H  A  Y  D  E  T  E  V  I  G  L  D  H  D  F  N  K  L  Q  H  K  L  L  L  Q  D  L  P  Y  G  V  V  S </second_frame>
            <third_frame>   N  L  L  K  *  L  Q  I  Y  S  C  K  K  V  R  V  Y  I  G  *  R  R  T  S  I  G  S  K  E  K  *  N  T  F  D  H  M  *  T  M  Q  R  Q  R  K  L  E  V  I  Q  G  S  K  T  Y  *  K  I  F  N  N  W  Q  V  M  W  R  I  Y  *  M  S  S  F  Q  K  F  N  N  P  I  S  S  F  V  A  L  R  L  F  I  L  R  I  S  L  L  W  R  L  R  R  *  K  E  E  L  L  I  L  T  V  *  G  Q  L  T  T  S  Q  I  Q  V  T  I  M  M  I  A  F  Q  W  T  G  E  D  D  S  F  M  L  M  M  K  Q  R  S  S  V  W  I  M  T  S  T  S  S  N  T  N  C  F  F  K  I  C  L  M  E  L  F   </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <orf_entry>
              <id_line>
                <gDNA id="C09HBa0165P17.1" strand="-"/>
                <serials PGL_serial="1" AGS_serial="1" PPS_serial="1"/>
                <orf_info>
                  <exon_boundaries>
                    <exon start="70094" stop="69579"/>
                  </exon_boundaries>
                  <frame>1</frame>
                  <number_coding_nucleotides>516</number_coding_nucleotides>
                  <number_encoded_amino_acids>172</number_encoded_amino_acids>
                </orf_info>
              </id_line>
              <predicted_protein_sequence>KSVEIAANLLVQEGTRLYWLKEDIDWLQREMKHIRSYVDDAKAKEVGGDSRVKNLLEDIQQLAGDVEDLLDEFLPKIQQSNKFICCLKTVYFANKFAMEIEKIKRRVADIDRVRTTYNITDTSNNNDDCIPMDRRRRFLHAYDETEVIGLDHDFNKLQHKLLLQDLPYGVVS</predicted_protein_sequence>
            </orf_entry>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
    <predicted_gene_location>
      <PGL_line PGL_serial="2" PGL_strand="+" PGL_start="79923" PGL_stop="80451"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="79923" e_stop="80451"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-only e_score="0.989"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="0.989">
            <gDNA_exon_boundary e_start="79923" e_stop="80451" e_length="529"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="79923" stop="80451"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-M462-R" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="2" AGS_serial="1" gDNA_strand="+"/>
          <translation>
            <gDNA_template>ATACCTGCAGTCACCACAATCGCTAGCGGTATACCTCCACATCTCTCAACTATACATCTACCAATATTTACCAAGTCTGGTGAAGTATTGGCCCAATTATCATCAACAAAATTACAGATTTTCTTGGTAAAGAGTTCAAAACTGTTCTCCGAATCTAGAGGTTGCAACACGTGGATTGAGAAATCCCCTCCTATGTATCTGCCTACATTACTATTTCGAGAGGTTATAATTATCCTACTGCCAATTTTTGAATCAGATTCAGGAAGGACGAGTTTTAGATCATCCCAAATTTCAACATCCCAAATGTCATCTAAAAGGATAACGTACCTTTTTATTTTCAAGAGTGATCTTAGGTTGTGTTCCAAGTTCTCTTTCCTTTCTTCTTCCGTCAGTCCAACTTGTTTGGCTATGTTAAGCAAGATTTCTCCCGCCCTTGGCTGCTGCGAGACATAGACCAATCCAGAACATTCAAATTGATGACGGACGTGCCTATAAAGTTTCTTGGCAAGAGTAGTTTTTCCCAAACCGG</gDNA_template>
            <first_frame> I  P  A  V  T  T  I  A  S  G  I  P  P  H  L  S  T  I  H  L  P  I  F  T  K  S  G  E  V  L  A  Q  L  S  S  T  K  L  Q  I  F  L  V  K  S  S  K  L  F  S  E  S  R  G  C  N  T  W  I  E  K  S  P  P  M  Y  L  P  T  L  L  F  R  E  V  I  I  I  L  L  P  I  F  E  S  D  S  G  R  T  S  F  R  S  S  Q  I  S  T  S  Q  M  S  S  K  R  I  T  Y  L  F  I  F  K  S  D  L  R  L  C  S  K  F  S  F  L  S  S  S  V  S  P  T  C  L  A  M  L  S  K  I  S  P  A  L  G  C  C  E  T  *  T  N  P  E  H  S  N  *  *  R  T  C  L  *  S  F  L  A  R  V  V  F  P  K  P  </first_frame>
            <second_frame>  Y  L  Q  S  P  Q  S  L  A  V  Y  L  H  I  S  Q  L  Y  I  Y  Q  Y  L  P  S  L  V  K  Y  W  P  N  Y  H  Q  Q  N  Y  R  F  S  W  *  R  V  Q  N  C  S  P  N  L  E  V  A  T  R  G  L  R  N  P  L  L  C  I  C  L  H  Y  Y  F  E  R  L  *  L  S  Y  C  Q  F  L  N  Q  I  Q  E  G  R  V  L  D  H  P  K  F  Q  H  P  K  C  H  L  K  G  *  R  T  F  L  F  S  R  V  I  L  G  C  V  P  S  S  L  S  F  L  L  P  S  V  Q  L  V  W  L  C  *  A  R  F  L  P  P  L  A  A  A  R  H  R  P  I  Q  N  I  Q  I  D  D  G  R  A  Y  K  V  S  W  Q  E  *  F  F  P  N  R </second_frame>
            <third_frame>   T  C  S  H  H  N  R  *  R  Y  T  S  T  S  L  N  Y  T  S  T  N  I  Y  Q  V  W  *  S  I  G  P  I  I  I  N  K  I  T  D  F  L  G  K  E  F  K  T  V  L  R  I  *  R  L  Q  H  V  D  *  E  I  P  S  Y  V  S  A  Y  I  T  I  S  R  G  Y  N  Y  P  T  A  N  F  *  I  R  F  R  K  D  E  F  *  I  I  P  N  F  N  I  P  N  V  I  *  K  D  N  V  P  F  Y  F  Q  E  *  S  *  V  V  F  Q  V  L  F  P  F  F  F  R  Q  S  N  L  F  G  Y  V  K  Q  D  F  S  R  P  W  L  L  R  D  I  D  Q  S  R  T  F  K  L  M  T  D  V  P  I  K  F  L  G  K  S  S  F  S  Q  T   </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <orf_entry>
              <id_line>
                <gDNA id="C09HBa0165P17.1" strand="+"/>
                <serials PGL_serial="2" AGS_serial="1" PPS_serial="1"/>
                <orf_info>
                  <exon_boundaries>
                    <exon start="79923" stop="80375"/>
                  </exon_boundaries>
                  <frame>0</frame>
                  <number_coding_nucleotides>450</number_coding_nucleotides>
                  <number_encoded_amino_acids>150</number_encoded_amino_acids>
                </orf_info>
              </id_line>
              <predicted_protein_sequence>IPAVTTIASGIPPHLSTIHLPIFTKSGEVLAQLSSTKLQIFLVKSSKLFSESRGCNTWIEKSPPMYLPTLLFREVIIILLPIFESDSGRTSFRSSQISTSQMSSKRITYLFIFKSDLRLCSKFSFLSSSVSPTCLAMLSKISPALGCCET*</predicted_protein_sequence>
            </orf_entry>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
  </PGL_module>
</GTH_output>
<!--
$ general statistics:
$ 4 chains have been computed
$ 
$ memory statistics:
$ 25072 bytes spliced alignments in total
$ 2 spliced alignments have been stored
$ 12536 bytes was the average size of a spliced alignment
$ 6704 bytes predicted gene locations in total
$ 2 predicted gene locations have been stored
$ 3352 bytes was the average size of a predicted gene location
$ 0 megabytes was the average size of the backtrace matrix
$ 4 backtrace matrices have been allocated
$ 
$ date finished: 2009-01-15 12:56:14
-->
