<?xml version="1.0" encoding="ISO-8859-1"?>
<GTH_output xmlns="http://www.genomethreader.org/GTH_output/" GTH_XML_version="1.1">
  <header xmlns="http://www.genomethreader.org/GTH_output/header/">
    <source program="GenomeThreader" version="0.9.54" build_date="2006-07-28 11:55:15" run_date="2009-12-01 09:03:58"/>
    <gDNA_template_files>
      <temp_name>/tmp/bac-submission-temp-C02HBa0125L12-8eUh4/GenomeThreader_SGN_U_tomato/un_xed_seqs</temp_name>
    </gDNA_template_files>
    <reference_files>
      <file ref_name="/tmp/bac-submission-temp-C02HBa0125L12-8eUh4/gth_cdna_fileCXGN::TomatoGenome::BACSubmission::Analysis::GenomeThreader::SGN_U_tomato" type="ESTcDNA"/>
    </reference_files>
    <splice_site_parameters parameter_type="Bayesian" species="arabidopsis"/>
    <parameters>
      <parameter name="bssmfile" value="arabidopsis"/>
      <parameter name="scorematrixfile" value="BLOSUM62"/>
      <parameter name="searchmode" value="forward=True,reverse=True)"/>
      <parameter name="translationtable" value="1"/>
      <parameter name="frompos" value="0"/>
      <parameter name="topos" value="0"/>
      <parameter name="width" value="0"/>
      <parameter name="verbose" value="False"/>
      <parameter name="skipalignmentout" value="False"/>
      <parameter name="showintronmaxlen" value="120"/>
      <parameter name="minorflen" value="64"/>
      <parameter name="showseqnums" value="False"/>
      <parameter name="gs2out" value="False"/>
      <parameter name="maskpolyatails" value="False"/>
      <parameter name="noautoindex" value="False"/>
      <parameter name="minmatchlen" value="20"/>
      <parameter name="seedlength" value="16"/>
      <parameter name="exdrop" value="2"/>
      <parameter name="online" value="False"/>
      <parameter name="inverse" value="False"/>
      <parameter name="exact" value="False"/>
      <parameter name="chainwf" value="0.500000"/>
      <parameter name="gcmaxgapwidth" value="1000000"/>
      <parameter name="gcmincoverage" value="50"/>
      <parameter name="introncutout" value="False"/>
      <parameter name="autointroncutout" value="0"/>
      <parameter name="icinitialdelta" value="50"/>
      <parameter name="iciterations" value="2"/>
      <parameter name="icdeltaincrease" value="50"/>
      <parameter name="icminremintronlen" value="10"/>
      <parameter name="nou12intronmodel" value="False"/>
      <parameter name="u12donorprob" value="0.990000"/>
      <parameter name="u12donorprob1mism" value="0.900000"/>
      <parameter name="probies" value="0.500000"/>
      <parameter name="probdelgen" value="0.030000"/>
      <parameter name="identityweight" value="2.000000"/>
      <parameter name="mismatchweight" value="-2.000000"/>
      <parameter name="undetcharweight" value="0.000000"/>
      <parameter name="deletionweight" value="-4.000000"/>
      <parameter name="dpminexonlen" value="5"/>
      <parameter name="dpminintronlen" value="50"/>
      <parameter name="shortexonpenal" value="100"/>
      <parameter name="shortintronpenal" value="100"/>
      <parameter name="wzerotransition" value="80"/>
      <parameter name="wdecreasedoutput" value="80"/>
      <parameter name="leadcutoffsmode" value="RELAXED"/>
      <parameter name="termcutoffsmode" value="STRICT"/>
      <parameter name="cutoffsminexonlen" value="5"/>
      <parameter name="scoreminexonlen" value="50"/>
      <parameter name="minaveragessp" value="0.500000"/>
      <parameter name="minalignmentscore" value="0.900000"/>
      <parameter name="maxalignmentscore" value="1.000000"/>
      <parameter name="mincoverage" value="0.900000"/>
      <parameter name="maxcoverage" value="100.000000"/>
      <parameter name="intermediate" value="False"/>
      <parameter name="sortags" value="False"/>
      <parameter name="sortagswf" value="1.000000"/>
      <parameter name="first" value="0"/>
      <parameter name="exondistri" value="False"/>
      <parameter name="introndistri" value="False"/>
      <parameter name="refseqcovdistri" value="False"/>
    </parameters>
    <overall_reference_type>ESTcDNA</overall_reference_type>
  </header>
  <alignment_module>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/bac-submission-temp-C02HBa0125L12-8eUh4/gth_cdna_fileCXGN::TomatoGenome::BACSubmission::Analysis::GenomeThreader::SGN_U_tomato" ref_id="SGN-U601842" ref_strand="+" ref_description="SGN-U601842 Tomato 200607#2 [1 ESTs aligned] ">
      <seq>gtgtttaattcatttcttctttgttatgacagtaatccatacaacaaaatcaaaatgccatattccgaaaagattataggcttttagatttgatttaacgaaatataagcaaaggcagattagttttcacaaatagtgttttggactcacttcccacttacacaatctctttattccttattcctacatatctggccaagaaattgataagattcgtcgaatctgaaatgaaaacagggacaagaaagcttttaatcatgctaagtgggaagctgtccaaaaagataaaaatctggaggcctgggagtacggaatctgaaagcacacaatgatagcctcttaaacaaatggtcatggagattcacaaaaggtgagaatgcaaaacggagtaagtcatcgagaccaaatatggtatgcaacacctgtggataacaaagcttactagctcttgtatggtttctctgtcgggaaaagcatctggactttctttagacgaattcctaggaaacaacatctttcaagttgggaaatggcagnaaatcagctttttggaatggccgtacccct</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C02HBa0125L12-8eUh4/GenomeThreader_SGN_U_tomato/un_xed_seqs" temp_id="C02HBa0125L12.1" temp_strand="+" temp_description="C02HBa0125L12.1  AC215391.2 htgs_phase:3 submitted_to_sgn_as:C02HBa0125L12 sequenced_by:kribb upload_account_name:korea">
        <position start="8901" stop="10066"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="9200" g_stop="9766" g_length="567"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="567" r_length="567" r_score="0.996"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C02HBa0125L12.1" gen_strand="+" ref_id="SGN-U601842" ref_strand="+">
        <total_alignment_score>0.996</total_alignment_score>
        <cumulative_length_of_scored_exons>567</cumulative_length_of_scored_exons>
        <coverage percentage="1.000" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C02HBa0125L12.1" gen_strand="+"/>
        <rDNA rDNA_id="SGN-U601842" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="9200" e_stop="9766"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>CTGTTTAATTCATTTCTTCTTTGTTATGACAGTAATCCATACAACAAAATCAAAATGCCATATTCCGAAAAGATTATAGGCTTTTAGATTTGATTTAACGAAATATAAGCAAAGGCAGATTAGTTTTCACAAATAGTGTTTTGGACTCACTTCCCACTTACACAATCTCTTTATTCCTTATTCCTACATATCTGGCCAAGAAATTGATAAGATTCGTCGAATCTGAAATGAAAACAGGGACAAGAAAGCTTTTAATCATGCTAAGTGGGAAGCTGTCCAAAAAGATAAAAATCTGGAGGCCTGGGAGTACGGAATCTGAAAGCACACAATGATAGCCTCTTAAACAAATGGTCATGGAGATTCACAAAAGGTGAGAATGCAAAACGGAGTAAGTCATCGAGACCAAATATGGTATGCAACACCTGTGGATAACAAAGCTTACTAGCTCTTGTATGGTTTCTCTGTCGGGAAAAGCATCTGGACTTTCTTTAGACGAATTCCTAGGAAACAACATCTTTCAAGTTGGGAAATGGCAGAAAATCAGCTTTTTGGAATGGCCGTACCCCT</genome_strand>
        <mrna_strand>GTGTTTAATTCATTTCTTCTTTGTTATGACAGTAATCCATACAACAAAATCAAAATGCCATATTCCGAAAAGATTATAGGCTTTTAGATTTGATTTAACGAAATATAAGCAAAGGCAGATTAGTTTTCACAAATAGTGTTTTGGACTCACTTCCCACTTACACAATCTCTTTATTCCTTATTCCTACATATCTGGCCAAGAAATTGATAAGATTCGTCGAATCTGAAATGAAAACAGGGACAAGAAAGCTTTTAATCATGCTAAGTGGGAAGCTGTCCAAAAAGATAAAAATCTGGAGGCCTGGGAGTACGGAATCTGAAAGCACACAATGATAGCCTCTTAAACAAATGGTCATGGAGATTCACAAAAGGTGAGAATGCAAAACGGAGTAAGTCATCGAGACCAAATATGGTATGCAACACCTGTGGATAACAAAGCTTACTAGCTCTTGTATGGTTTCTCTGTCGGGAAAAGCATCTGGACTTTCTTTAGACGAATTCCTAGGAAACAACATCTTTCAAGTTGGGAAATGGCAGNAAATCAGCTTTTTGGAATGGCCGTACCCCT</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
    <total_number_ESTs_reported>1</total_number_ESTs_reported>
    </alignment_module>
  <PGL_module xmlns="http://www.genomethreader.org/GTH_output/PGL_module/">
    <predicted_gene_location>
      <PGL_line PGL_serial="1" PGL_strand="+" PGL_start="9200" PGL_stop="9766"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="9200" e_stop="9766"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-only e_score="0.996"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="0.996">
            <gDNA_exon_boundary e_start="9200" e_stop="9766" e_length="567"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="9200" stop="9766"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-U601842" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="1" AGS_serial="1" gDNA_strand="+"/>
          <translation>
            <gDNA_template>CTGTTTAATTCATTTCTTCTTTGTTATGACAGTAATCCATACAACAAAATCAAAATGCCATATTCCGAAAAGATTATAGGCTTTTAGATTTGATTTAACGAAATATAAGCAAAGGCAGATTAGTTTTCACAAATAGTGTTTTGGACTCACTTCCCACTTACACAATCTCTTTATTCCTTATTCCTACATATCTGGCCAAGAAATTGATAAGATTCGTCGAATCTGAAATGAAAACAGGGACAAGAAAGCTTTTAATCATGCTAAGTGGGAAGCTGTCCAAAAAGATAAAAATCTGGAGGCCTGGGAGTACGGAATCTGAAAGCACACAATGATAGCCTCTTAAACAAATGGTCATGGAGATTCACAAAAGGTGAGAATGCAAAACGGAGTAAGTCATCGAGACCAAATATGGTATGCAACACCTGTGGATAACAAAGCTTACTAGCTCTTGTATGGTTTCTCTGTCGGGAAAAGCATCTGGACTTTCTTTAGACGAATTCCTAGGAAACAACATCTTTCAAGTTGGGAAATGGCAGAAAATCAGCTTTTTGGAATGGCCGTACCCCT</gDNA_template>
            <first_frame> L  F  N  S  F  L  L  C  Y  D  S  N  P  Y  N  K  I  K  M  P  Y  S  E  K  I  I  G  F  *  I  *  F  N  E  I  *  A  K  A  D  *  F  S  Q  I  V  F  W  T  H  F  P  L  T  Q  S  L  Y  S  L  F  L  H  I  W  P  R  N  *  *  D  S  S  N  L  K  *  K  Q  G  Q  E  S  F  *  S  C  *  V  G  S  C  P  K  R  *  K  S  G  G  L  G  V  R  N  L  K  A  H  N  D  S  L  L  N  K  W  S  W  R  F  T  K  G  E  N  A  K  R  S  K  S  S  R  P  N  M  V  C  N  T  C  G  *  Q  S  L  L  A  L  V  W  F  L  C  R  E  K  H  L  D  F  L  *  T  N  S  *  E  T  T  S  F  K  L  G  N  G  R  K  S  A  F  W  N  G  R  T  P </first_frame>
            <second_frame>  C  L  I  H  F  F  F  V  M  T  V  I  H  T  T  K  S  K  C  H  I  P  K  R  L  *  A  F  R  F  D  L  T  K  Y  K  Q  R  Q  I  S  F  H  K  *  C  F  G  L  T  S  H  L  H  N  L  F  I  P  Y  S  Y  I  S  G  Q  E  I  D  K  I  R  R  I  *  N  E  N  R  D  K  K  A  F  N  H  A  K  W  E  A  V  Q  K  D  K  N  L  E  A  W  E  Y  G  I  *  K  H  T  M  I  A  S  *  T  N  G  H  G  D  S  Q  K  V  R  M  Q  N  G  V  S  H  R  D  Q  I  W  Y  A  T  P  V  D  N  K  A  Y  *  L  L  Y  G  F  S  V  G  K  S  I  W  T  F  F  R  R  I  P  R  K  Q  H  L  S  S  W  E  M  A  E  N  Q  L  F  G  M  A  V  P   </second_frame>
            <third_frame>   V  *  F  I  S  S  L  L  *  Q  *  S  I  Q  Q  N  Q  N  A  I  F  R  K  D  Y  R  L  L  D  L  I  *  R  N  I  S  K  G  R  L  V  F  T  N  S  V  L  D  S  L  P  T  Y  T  I  S  L  F  L  I  P  T  Y  L  A  K  K  L  I  R  F  V  E  S  E  M  K  T  G  T  R  K  L  L  I  M  L  S  G  K  L  S  K  K  I  K  I  W  R  P  G  S  T  E  S  E  S  T  Q  *  *  P  L  K  Q  M  V  M  E  I  H  K  R  *  E  C  K  T  E  *  V  I  E  T  K  Y  G  M  Q  H  L  W  I  T  K  L  T  S  S  C  M  V  S  L  S  G  K  A  S  G  L  S  L  D  E  F  L  G  N  N  I  F  Q  V  G  K  W  Q  K  I  S  F  L  E  W  P  Y  P  </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <orf_entry>
              <id_line>
                <gDNA id="C02HBa0125L12.1" strand="+"/>
                <serials PGL_serial="1" AGS_serial="1" PPS_serial="1"/>
                <orf_info>
                  <exon_boundaries>
                    <exon start="9298" stop="9531"/>
                  </exon_boundaries>
                  <frame>2</frame>
                  <number_coding_nucleotides>231</number_coding_nucleotides>
                  <number_encoded_amino_acids>77</number_encoded_amino_acids>
                </orf_info>
              </id_line>
              <predicted_protein_sequence>RNISKGRLVFTNSVLDSLPTYTISLFLIPTYLAKKLIRFVESEMKTGTRKLLIMLSGKLSKKIKIWRPGSTESESTQ*</predicted_protein_sequence>
            </orf_entry>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
  </PGL_module>
</GTH_output>
<!--
$ general statistics:
$ 2 chains have been computed
$ 
$ memory statistics:
$ 2040 bytes spliced alignments in total
$ 1 spliced alignments have been stored
$ 2040 bytes was the average size of a spliced alignment
$ 5528 bytes predicted gene locations in total
$ 1 predicted gene locations have been stored
$ 5528 bytes was the average size of a predicted gene location
$ 1 megabytes was the average size of the backtrace matrix
$ 2 backtrace matrices have been allocated
$ 
$ date finished: 2009-12-01 09:04:11
-->
