<?xml version="1.0" encoding="ISO-8859-1"?>
<GTH_output xmlns="http://www.genomethreader.org/GTH_output/" GTH_XML_version="1.1">
  <header xmlns="http://www.genomethreader.org/GTH_output/header/">
    <source program="GenomeThreader" version="0.9.54" build_date="2006-07-28 11:55:15" run_date="2009-12-01 07:51:03"/>
    <gDNA_template_files>
      <temp_name>/tmp/bac-submission-temp-C01HBa0262O22-YHjxw/GenomeThreader_SGN_markers/un_xed_seqs</temp_name>
    </gDNA_template_files>
    <reference_files>
      <file ref_name="/tmp/bac-submission-temp-C01HBa0262O22-YHjxw/gth_cdna_fileCXGN::TomatoGenome::BACSubmission::Analysis::GenomeThreader::SGN_markers" type="ESTcDNA"/>
    </reference_files>
    <splice_site_parameters parameter_type="Bayesian" species="arabidopsis"/>
    <parameters>
      <parameter name="bssmfile" value="arabidopsis"/>
      <parameter name="scorematrixfile" value="BLOSUM62"/>
      <parameter name="searchmode" value="forward=True,reverse=True)"/>
      <parameter name="translationtable" value="1"/>
      <parameter name="frompos" value="0"/>
      <parameter name="topos" value="0"/>
      <parameter name="width" value="0"/>
      <parameter name="verbose" value="False"/>
      <parameter name="skipalignmentout" value="False"/>
      <parameter name="showintronmaxlen" value="120"/>
      <parameter name="minorflen" value="64"/>
      <parameter name="showseqnums" value="False"/>
      <parameter name="gs2out" value="False"/>
      <parameter name="maskpolyatails" value="False"/>
      <parameter name="noautoindex" value="False"/>
      <parameter name="minmatchlen" value="20"/>
      <parameter name="seedlength" value="16"/>
      <parameter name="exdrop" value="2"/>
      <parameter name="online" value="False"/>
      <parameter name="inverse" value="False"/>
      <parameter name="exact" value="False"/>
      <parameter name="chainwf" value="0.500000"/>
      <parameter name="gcmaxgapwidth" value="1000000"/>
      <parameter name="gcmincoverage" value="50"/>
      <parameter name="introncutout" value="False"/>
      <parameter name="autointroncutout" value="0"/>
      <parameter name="icinitialdelta" value="50"/>
      <parameter name="iciterations" value="2"/>
      <parameter name="icdeltaincrease" value="50"/>
      <parameter name="icminremintronlen" value="10"/>
      <parameter name="nou12intronmodel" value="False"/>
      <parameter name="u12donorprob" value="0.990000"/>
      <parameter name="u12donorprob1mism" value="0.900000"/>
      <parameter name="probies" value="0.500000"/>
      <parameter name="probdelgen" value="0.030000"/>
      <parameter name="identityweight" value="2.000000"/>
      <parameter name="mismatchweight" value="-2.000000"/>
      <parameter name="undetcharweight" value="0.000000"/>
      <parameter name="deletionweight" value="-4.000000"/>
      <parameter name="dpminexonlen" value="5"/>
      <parameter name="dpminintronlen" value="50"/>
      <parameter name="shortexonpenal" value="100"/>
      <parameter name="shortintronpenal" value="100"/>
      <parameter name="wzerotransition" value="80"/>
      <parameter name="wdecreasedoutput" value="80"/>
      <parameter name="leadcutoffsmode" value="RELAXED"/>
      <parameter name="termcutoffsmode" value="STRICT"/>
      <parameter name="cutoffsminexonlen" value="5"/>
      <parameter name="scoreminexonlen" value="50"/>
      <parameter name="minaveragessp" value="0.500000"/>
      <parameter name="minalignmentscore" value="0.900000"/>
      <parameter name="maxalignmentscore" value="1.000000"/>
      <parameter name="mincoverage" value="0.900000"/>
      <parameter name="maxcoverage" value="100.000000"/>
      <parameter name="intermediate" value="False"/>
      <parameter name="sortags" value="False"/>
      <parameter name="sortagswf" value="1.000000"/>
      <parameter name="first" value="0"/>
      <parameter name="exondistri" value="False"/>
      <parameter name="introndistri" value="False"/>
      <parameter name="refseqcovdistri" value="False"/>
    </parameters>
    <overall_reference_type>ESTcDNA</overall_reference_type>
  </header>
  <alignment_module>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/bac-submission-temp-C01HBa0262O22-YHjxw/gth_cdna_fileCXGN::TomatoGenome::BACSubmission::Analysis::GenomeThreader::SGN_markers" ref_id="T1650" ref_strand="+" ref_description="T1650">
      <seq>gcaaggaatatctcgattcaattcttcgtggtcccataagcattacactgaggcatcgtctccagtgtcacgtgattagagattcagctaaaagtgatctggatagtgaagagcccatacttgttctcaacgaagtcacaattgaccgtgggatttcatcatttttaacaaatctagaatgctattgcgataattcttttgttacttgcgtacaaagggatggcttaattttatcgacaacatctggaagcacagcatattctcttgcagctggaggatcaatggtccatcctcaggttcccggcatcctctttacacctatctgcccacattctttatcctttcgccctctcattttgcccgagtatgtgacaatacgagtacaagtacctttcaaca</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C01HBa0262O22-YHjxw/GenomeThreader_SGN_markers/un_xed_seqs" temp_id="C01HBa0262O22.1" temp_strand="-" temp_description="C01HBa0262O22.1  AC225025.1 htgs_phase:1 submitted_to_sgn_as:C01HBa0262O22 upload_account_name:manual">
        <position start="80579" stop="79179"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="80280" g_stop="79985" g_length="296"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="296" r_length="296" r_score="0.993"/>
        </exon>
        <intron i_serial="1">
          <gDNA_intron_boundary i_start="79984" i_stop="79582" i_length="403">
            <donor d_prob="0.999" d_score="1.00"/>
            <acceptor a_prob="0.842" a_score="1.00"/>
          </gDNA_intron_boundary>
        </intron>
        <exon e_serial="2">
          <gDNA_exon_boundary g_start="79581" g_stop="79479" g_length="103"/>
          <reference_exon_boundary r_type="cDNA" r_start="297" r_stop="399" r_length="103" r_score="1.000"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C01HBa0262O22.1" gen_strand="-" ref_id="T1650" ref_strand="+">
        <total_alignment_score>0.995</total_alignment_score>
        <cumulative_length_of_scored_exons>399</cumulative_length_of_scored_exons>
        <coverage percentage="1.000" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C01HBa0262O22.1" gen_strand="-"/>
        <rDNA rDNA_id="T1650" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="80280" e_stop="79985"/>
          <exon e_start="79581" e_stop="79479"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>ACAAGGAATATCTCGATTCAATTCTTCGTGGTCCCATAAGCATTACACTGAGGCATCGTCTCCAGTGTCACGTGATTAGAGATTCAGCTAAAAGTGATCTGGATAGTGAAGAGCCCATACTTGTTCTCAACGAAGTCACAATTGACCGTGGGATTTCATCATTTTTAACAAATCTAGAATGCTATTGCGATAATTCTTTTGTTACTTGCGTACAAGGGGATGGCTTAATTTTATCGACAACATCTGGAAGCACAGCATATTCTCTTGCAGCTGGAGGATCAATGGTCCATCCTCAGGTAAATCCTCTCATACTCGTCACTTTTATAACGATTTATCTCAAGCTGACATGATTTGTTTTAATAAGCTACTGCTGGTTAGTAATAATTCTGGACGTGTTATAAGTTATCCGGGTCTAACAGTTATTTTACTGCAACTTAGGCTGAGTGTCTGTTGGAAAAACCCCTCTACCTTTAAGGTAGGGGTAAGGTTTGCGTACAATTTACCCTTCCCAGACCTCACTTTGTGGGATTACACTGAATATGTTGTTGTCGTAGATAGATTTTTGCTTCCATGTTTAGTATTTCATTTTGCAATTAGCACAATGACGATGCAATGTGTTTTTCCATAGTTATCTCTATTTGATGTCTTTCGAGTTGATTATAACCTTAACAGCATTACTGTTATGACCAAAAATTGCAGGTTCCCGGCATCCTCTTTACACCTATCTGCCCACATTCTTTATCCTTTCGCCCTCTCATTTTGCCCGAGTATGTGACAATACGAGTACAAGTACCTTTCAACA</genome_strand>
        <mrna_strand>GCAAGGAATATCTCGATTCAATTCTTCGTGGTCCCATAAGCATTACACTGAGGCATCGTCTCCAGTGTCACGTGATTAGAGATTCAGCTAAAAGTGATCTGGATAGTGAAGAGCCCATACTTGTTCTCAACGAAGTCACAATTGACCGTGGGATTTCATCATTTTTAACAAATCTAGAATGCTATTGCGATAATTCTTTTGTTACTTGCGTACAAAGGGATGGCTTAATTTTATCGACAACATCTGGAAGCACAGCATATTCTCTTGCAGCTGGAGGATCAATGGTCCATCCTCAG...................................................................................................................................................................................................................................................................................................................................................................................................................GTTCCCGGCATCCTCTTTACACCTATCTGCCCACATTCTTTATCCTTTCGCCCTCTCATTTTGCCCGAGTATGTGACAATACGAGTACAAGTACCTTTCAACA</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
    <total_number_ESTs_reported>1</total_number_ESTs_reported>
    </alignment_module>
  <PGL_module xmlns="http://www.genomethreader.org/GTH_output/PGL_module/">
    <predicted_gene_location>
      <PGL_line PGL_serial="1" PGL_strand="-" PGL_start="80280" PGL_stop="79479"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="80280" e_stop="79985"/>
            <exon e_start="79581" e_stop="79479"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-intron don_prob="0.999" acc_prob="0.842" e_score="0.993"/>
          <exon-only e_score="1.000"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="0.993">
            <gDNA_exon_boundary e_start="80280" e_stop="79985" e_length="296"/>
          </exon>
          <intron i_serial="1" don_prob="0.999" acc_prob="0.842">
            <gDNA_intron_boundary i_start="79984" i_stop="79582" i_length="403"/>
          </intron>
          <exon e_serial="2" e_score="1.000">
            <gDNA_exon_boundary e_start="79581" e_stop="79479" e_length="103"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="80280" stop="79985"/>
              <exon start="79581" stop="79479"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="T1650" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="1" AGS_serial="1" gDNA_strand="-"/>
          <translation>
            <gDNA_template>ACAAGGAATATCTCGATTCAATTCTTCGTGGTCCCATAAGCATTACACTGAGGCATCGTCTCCAGTGTCACGTGATTAGAGATTCAGCTAAAAGTGATCTGGATAGTGAAGAGCCCATACTTGTTCTCAACGAAGTCACAATTGACCGTGGGATTTCATCATTTTTAACAAATCTAGAATGCTATTGCGATAATTCTTTTGTTACTTGCGTACAAGGGGATGGCTTAATTTTATCGACAACATCTGGAAGCACAGCATATTCTCTTGCAGCTGGAGGATCAATGGTCCATCCTCAG : GTTCCCGGCATCCTCTTTACACCTATCTGCCCACATTCTTTATCCTTTCGCCCTCTCATTTTGCCCGAGTATGTGACAATACGAGTACAAGTACCTTTCAACA</gDNA_template>
            <first_frame> T  R  N  I  S  I  Q  F  F  V  V  P  *  A  L  H  *  G  I  V  S  S  V  T  *  L  E  I  Q  L  K  V  I  W  I  V  K  S  P  Y  L  F  S  T  K  S  Q  L  T  V  G  F  H  H  F  *  Q  I  *  N  A  I  A  I  I  L  L  L  L  A  Y  K  G  M  A  *  F  Y  R  Q  H  L  E  A  Q  H  I  L  L  Q  L  E  D  Q  W  S  I  L  R :   F  P  A  S  S  L  H  L  S  A  H  I  L  Y  P  F  A  L  S  F  C  P  S  M  *  Q  Y  E  Y  K  Y  L  S  T </first_frame>
            <second_frame>  Q  G  I  S  R  F  N  S  S  W  S  H  K  H  Y  T  E  A  S  S  P  V  S  R  D  *  R  F  S  *  K  *  S  G  *  *  R  A  H  T  C  S  Q  R  S  H  N  *  P  W  D  F  I  I  F  N  K  S  R  M  L  L  R  *  F  F  C  Y  L  R  T  R  G  W  L  N  F  I  D  N  I  W  K  H  S  I  F  S  C  S  W  R  I  N  G  P  S  S   : G  S  R  H  P  L  Y  T  Y  L  P  T  F  F  I  L  S  P  S  H  F  A  R  V  C  D  N  T  S  T  S  T  F  Q   </second_frame>
            <third_frame>   K  E  Y  L  D  S  I  L  R  G  P  I  S  I  T  L  R  H  R  L  Q  C  H  V  I  R  D  S  A  K  S  D  L  D  S  E  E  P  I  L  V  L  N  E  V  T  I  D  R  G  I  S  S  F  L  T  N  L  E  C  Y  C  D  N  S  F  V  T  C  V  Q  G  D  G  L  I  L  S  T  T  S  G  S  T  A  Y  S  L  A  A  G  G  S  M  V  H  P  Q  :  V  P  G  I  L  F  T  P  I  C  P  H  S  L  S  F  R  P  L  I  L  P  E  Y  V  T  I  R  V  Q  V  P  F  N  </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <orf_entry>
              <id_line>
                <gDNA id="C01HBa0262O22.1" strand="-"/>
                <serials PGL_serial="1" AGS_serial="1" PPS_serial="1"/>
                <orf_info>
                  <exon_boundaries>
                    <exon start="80278" stop="79985"/>
                    <exon start="79581" stop="79480"/>
                  </exon_boundaries>
                  <frame>2</frame>
                  <number_coding_nucleotides>396</number_coding_nucleotides>
                  <number_encoded_amino_acids>132</number_encoded_amino_acids>
                </orf_info>
              </id_line>
              <predicted_protein_sequence>KEYLDSILRGPISITLRHRLQCHVIRDSAKSDLDSEEPILVLNEVTIDRGISSFLTNLECYCDNSFVTCVQGDGLILSTTSGSTAYSLAAGGSMVHPQVPGILFTPICPHSLSFRPLILPEYVTIRVQVPFN</predicted_protein_sequence>
            </orf_entry>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
  </PGL_module>
</GTH_output>
<!--
$ general statistics:
$ 9 chains have been computed
$ 
$ memory statistics:
$ 2280 bytes spliced alignments in total
$ 1 spliced alignments have been stored
$ 2280 bytes was the average size of a spliced alignment
$ 5560 bytes predicted gene locations in total
$ 1 predicted gene locations have been stored
$ 5560 bytes was the average size of a predicted gene location
$ 0 megabytes was the average size of the backtrace matrix
$ 10 backtrace matrices have been allocated
$ 
$ date finished: 2009-12-01 07:51:07
-->
