<?xml version="1.0" encoding="ISO-8859-1"?>
<GTH_output xmlns="http://www.genomethreader.org/GTH_output/" GTH_XML_version="1.1">
  <header xmlns="http://www.genomethreader.org/GTH_output/header/">
    <source program="GenomeThreader" version="0.9.54" build_date="2006-07-28 11:55:15" run_date="2009-12-03 20:30:06"/>
    <gDNA_template_files>
      <temp_name>/tmp/bac-submission-temp-C01HBa0034P21-cBhH0/GenomeThreader_SGN_markers/un_xed_seqs</temp_name>
    </gDNA_template_files>
    <reference_files>
      <file ref_name="/tmp/bac-submission-temp-C01HBa0034P21-cBhH0/gth_cdna_fileCXGN::TomatoGenome::BACSubmission::Analysis::GenomeThreader::SGN_markers" type="ESTcDNA"/>
    </reference_files>
    <splice_site_parameters parameter_type="Bayesian" species="arabidopsis"/>
    <parameters>
      <parameter name="bssmfile" value="arabidopsis"/>
      <parameter name="scorematrixfile" value="BLOSUM62"/>
      <parameter name="searchmode" value="forward=True,reverse=True)"/>
      <parameter name="translationtable" value="1"/>
      <parameter name="frompos" value="0"/>
      <parameter name="topos" value="0"/>
      <parameter name="width" value="0"/>
      <parameter name="verbose" value="False"/>
      <parameter name="skipalignmentout" value="False"/>
      <parameter name="showintronmaxlen" value="120"/>
      <parameter name="minorflen" value="64"/>
      <parameter name="showseqnums" value="False"/>
      <parameter name="gs2out" value="False"/>
      <parameter name="maskpolyatails" value="False"/>
      <parameter name="noautoindex" value="False"/>
      <parameter name="minmatchlen" value="20"/>
      <parameter name="seedlength" value="16"/>
      <parameter name="exdrop" value="2"/>
      <parameter name="online" value="False"/>
      <parameter name="inverse" value="False"/>
      <parameter name="exact" value="False"/>
      <parameter name="chainwf" value="0.500000"/>
      <parameter name="gcmaxgapwidth" value="1000000"/>
      <parameter name="gcmincoverage" value="50"/>
      <parameter name="introncutout" value="False"/>
      <parameter name="autointroncutout" value="0"/>
      <parameter name="icinitialdelta" value="50"/>
      <parameter name="iciterations" value="2"/>
      <parameter name="icdeltaincrease" value="50"/>
      <parameter name="icminremintronlen" value="10"/>
      <parameter name="nou12intronmodel" value="False"/>
      <parameter name="u12donorprob" value="0.990000"/>
      <parameter name="u12donorprob1mism" value="0.900000"/>
      <parameter name="probies" value="0.500000"/>
      <parameter name="probdelgen" value="0.030000"/>
      <parameter name="identityweight" value="2.000000"/>
      <parameter name="mismatchweight" value="-2.000000"/>
      <parameter name="undetcharweight" value="0.000000"/>
      <parameter name="deletionweight" value="-4.000000"/>
      <parameter name="dpminexonlen" value="5"/>
      <parameter name="dpminintronlen" value="50"/>
      <parameter name="shortexonpenal" value="100"/>
      <parameter name="shortintronpenal" value="100"/>
      <parameter name="wzerotransition" value="80"/>
      <parameter name="wdecreasedoutput" value="80"/>
      <parameter name="leadcutoffsmode" value="RELAXED"/>
      <parameter name="termcutoffsmode" value="STRICT"/>
      <parameter name="cutoffsminexonlen" value="5"/>
      <parameter name="scoreminexonlen" value="50"/>
      <parameter name="minaveragessp" value="0.500000"/>
      <parameter name="minalignmentscore" value="0.900000"/>
      <parameter name="maxalignmentscore" value="1.000000"/>
      <parameter name="mincoverage" value="0.900000"/>
      <parameter name="maxcoverage" value="100.000000"/>
      <parameter name="intermediate" value="False"/>
      <parameter name="sortags" value="False"/>
      <parameter name="sortagswf" value="1.000000"/>
      <parameter name="first" value="0"/>
      <parameter name="exondistri" value="False"/>
      <parameter name="introndistri" value="False"/>
      <parameter name="refseqcovdistri" value="False"/>
    </parameters>
    <overall_reference_type>ESTcDNA</overall_reference_type>
  </header>
  <alignment_module>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/bac-submission-temp-C01HBa0034P21-cBhH0/gth_cdna_fileCXGN::TomatoGenome::BACSubmission::Analysis::GenomeThreader::SGN_markers" ref_id="CT165-F" ref_strand="+" ref_description="CT165-F">
      <seq>catttcttttgctggaccagcagcttctactacacccgcgtcttcacggctgatgcctgtaggtcaaaacaagagacacaaactgataaatgaaatggaacccgactctagcccactgctgaagccgcagacacgtggaacactccatgccggtgaagatgccaaggctaagagtcatatggctcaaagagaaacaagatttggtggtagcagtagccgggagcttagccaacaggatgattcacgcccattcactcatcccggggagcttgttatttgcaaaaaaaaaaaaaa</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C01HBa0034P21-cBhH0/GenomeThreader_SGN_markers/un_xed_seqs" temp_id="C01HBa0034P21.2" temp_strand="-" temp_description="C01HBa0034P21.2  AC238507.3 htgs_phase:2 submitted_to_sgn_as:C01HBa0034P21 upload_account_name:manual">
        <position start="99127" stop="98234"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="98827" g_stop="98534" g_length="294"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="294" r_length="294" r_score="0.993"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C01HBa0034P21.2" gen_strand="-" ref_id="CT165-F" ref_strand="+">
        <total_alignment_score>0.993</total_alignment_score>
        <cumulative_length_of_scored_exons>294</cumulative_length_of_scored_exons>
        <coverage percentage="1.000" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C01HBa0034P21.2" gen_strand="-"/>
        <rDNA rDNA_id="CT165-F" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="98827" e_stop="98534"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>CATTTCTTTTGCTGGACCAGCAGCTTCTACTACACCCGCGTCTTCACGGCTGATGCCTGTAGGTCAAAACAAGAGACACAAACTGATAAATGAAATGGAACCCGACTCTAGCCCACTGCTGAAGCCGCAGACACGTGGAACACTCCATGCCGGTGAAGATGCCAAGGCTAAGAGTCATATGGCTCAAAGAGAAACAAGATTTGGTGGTAGCAGTAGCCGGGAGCTTAGCCAACAGGATGATTCACGCCCATTCACTCATCCCGGGGAGCTTGTTATTTGCAAAAAGAAAAGAAA</genome_strand>
        <mrna_strand>CATTTCTTTTGCTGGACCAGCAGCTTCTACTACACCCGCGTCTTCACGGCTGATGCCTGTAGGTCAAAACAAGAGACACAAACTGATAAATGAAATGGAACCCGACTCTAGCCCACTGCTGAAGCCGCAGACACGTGGAACACTCCATGCCGGTGAAGATGCCAAGGCTAAGAGTCATATGGCTCAAAGAGAAACAAGATTTGGTGGTAGCAGTAGCCGGGAGCTTAGCCAACAGGATGATTCACGCCCATTCACTCATCCCGGGGAGCTTGTTATTTGCAAAAAAAAAAAAAA</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/bac-submission-temp-C01HBa0034P21-cBhH0/gth_cdna_fileCXGN::TomatoGenome::BACSubmission::Analysis::GenomeThreader::SGN_markers" ref_id="CT165-R" ref_strand="+" ref_description="CT165-R">
      <seq>ttttttttttttttgcaaataacaagctccccgggatgagtgaatgggcgtgaatcatcctgttggctaagctcccggctactgctaccaccaaatcttgtttctctttgagccatatgactcttagccttggcatcttcaccggcatggagtgttccacgtgtctgcggcttcagcagtgggctagagtcgggttccatttcatttatcagtttgtgtctcttgttttgacctacaggcatcagccgtgaagacgcgggtgtagtagaagctgctggtccagcaaaagaaatg</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C01HBa0034P21-cBhH0/GenomeThreader_SGN_markers/un_xed_seqs" temp_id="C01HBa0034P21.2" temp_strand="+" temp_description="C01HBa0034P21.2  AC238507.3 htgs_phase:2 submitted_to_sgn_as:C01HBa0034P21 upload_account_name:manual">
        <position start="98234" stop="99127"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="98534" g_stop="98827" g_length="294"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="294" r_length="294" r_score="0.993"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C01HBa0034P21.2" gen_strand="+" ref_id="CT165-R" ref_strand="+">
        <total_alignment_score>0.993</total_alignment_score>
        <cumulative_length_of_scored_exons>294</cumulative_length_of_scored_exons>
        <coverage percentage="1.000" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C01HBa0034P21.2" gen_strand="+"/>
        <rDNA rDNA_id="CT165-R" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="98534" e_stop="98827"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>TTTCTTTTCTTTTTGCAAATAACAAGCTCCCCGGGATGAGTGAATGGGCGTGAATCATCCTGTTGGCTAAGCTCCCGGCTACTGCTACCACCAAATCTTGTTTCTCTTTGAGCCATATGACTCTTAGCCTTGGCATCTTCACCGGCATGGAGTGTTCCACGTGTCTGCGGCTTCAGCAGTGGGCTAGAGTCGGGTTCCATTTCATTTATCAGTTTGTGTCTCTTGTTTTGACCTACAGGCATCAGCCGTGAAGACGCGGGTGTAGTAGAAGCTGCTGGTCCAGCAAAAGAAATG</genome_strand>
        <mrna_strand>TTTTTTTTTTTTTTGCAAATAACAAGCTCCCCGGGATGAGTGAATGGGCGTGAATCATCCTGTTGGCTAAGCTCCCGGCTACTGCTACCACCAAATCTTGTTTCTCTTTGAGCCATATGACTCTTAGCCTTGGCATCTTCACCGGCATGGAGTGTTCCACGTGTCTGCGGCTTCAGCAGTGGGCTAGAGTCGGGTTCCATTTCATTTATCAGTTTGTGTCTCTTGTTTTGACCTACAGGCATCAGCCGTGAAGACGCGGGTGTAGTAGAAGCTGCTGGTCCAGCAAAAGAAATG</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
    <total_number_ESTs_reported>2</total_number_ESTs_reported>
    </alignment_module>
  <PGL_module xmlns="http://www.genomethreader.org/GTH_output/PGL_module/">
    <predicted_gene_location>
      <PGL_line PGL_serial="1" PGL_strand="-" PGL_start="98827" PGL_stop="98534"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="98827" e_stop="98534"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-only e_score="0.993"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="0.993">
            <gDNA_exon_boundary e_start="98827" e_stop="98534" e_length="294"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="98827" stop="98534"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="CT165-F" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="1" AGS_serial="1" gDNA_strand="-"/>
          <translation>
            <gDNA_template>CATTTCTTTTGCTGGACCAGCAGCTTCTACTACACCCGCGTCTTCACGGCTGATGCCTGTAGGTCAAAACAAGAGACACAAACTGATAAATGAAATGGAACCCGACTCTAGCCCACTGCTGAAGCCGCAGACACGTGGAACACTCCATGCCGGTGAAGATGCCAAGGCTAAGAGTCATATGGCTCAAAGAGAAACAAGATTTGGTGGTAGCAGTAGCCGGGAGCTTAGCCAACAGGATGATTCACGCCCATTCACTCATCCCGGGGAGCTTGTTATTTGCAAAAAGAAAAGAAA</gDNA_template>
            <first_frame> H  F  F  C  W  T  S  S  F  Y  Y  T  R  V  F  T  A  D  A  C  R  S  K  Q  E  T  Q  T  D  K  *  N  G  T  R  L  *  P  T  A  E  A  A  D  T  W  N  T  P  C  R  *  R  C  Q  G  *  E  S  Y  G  S  K  R  N  K  I  W  W  *  Q  *  P  G  A  *  P  T  G  *  F  T  P  I  H  S  S  R  G  A  C  Y  L  Q  K  E  K  K </first_frame>
            <second_frame>  I  S  F  A  G  P  A  A  S  T  T  P  A  S  S  R  L  M  P  V  G  Q  N  K  R  H  K  L  I  N  E  M  E  P  D  S  S  P  L  L  K  P  Q  T  R  G  T  L  H  A  G  E  D  A  K  A  K  S  H  M  A  Q  R  E  T  R  F  G  G  S  S  S  R  E  L  S  Q  Q  D  D  S  R  P  F  T  H  P  G  E  L  V  I  C  K  K  K  R   </second_frame>
            <third_frame>   F  L  L  L  D  Q  Q  L  L  L  H  P  R  L  H  G  *  C  L  *  V  K  T  R  D  T  N  *  *  M  K  W  N  P  T  L  A  H  C  *  S  R  R  H  V  E  H  S  M  P  V  K  M  P  R  L  R  V  I  W  L  K  E  K  Q  D  L  V  V  A  V  A  G  S  L  A  N  R  M  I  H  A  H  S  L  I  P  G  S  L  L  F  A  K  R  K  E  </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <orf_entry>
              <id_line>
                <gDNA id="C01HBa0034P21.2" strand="-"/>
                <serials PGL_serial="1" AGS_serial="1" PPS_serial="1"/>
                <orf_info>
                  <exon_boundaries>
                    <exon start="98826" stop="98536"/>
                  </exon_boundaries>
                  <frame>1</frame>
                  <number_coding_nucleotides>291</number_coding_nucleotides>
                  <number_encoded_amino_acids>97</number_encoded_amino_acids>
                </orf_info>
              </id_line>
              <predicted_protein_sequence>ISFAGPAASTTPASSRLMPVGQNKRHKLINEMEPDSSPLLKPQTRGTLHAGEDAKAKSHMAQRETRFGGSSSRELSQQDDSRPFTHPGELVICKKKR</predicted_protein_sequence>
            </orf_entry>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
    <predicted_gene_location>
      <PGL_line PGL_serial="2" PGL_strand="+" PGL_start="98534" PGL_stop="98827"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="98534" e_stop="98827"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-only e_score="0.993"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="0.993">
            <gDNA_exon_boundary e_start="98534" e_stop="98827" e_length="294"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="98534" stop="98827"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="CT165-R" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="2" AGS_serial="1" gDNA_strand="+"/>
          <translation>
            <gDNA_template>TTTCTTTTCTTTTTGCAAATAACAAGCTCCCCGGGATGAGTGAATGGGCGTGAATCATCCTGTTGGCTAAGCTCCCGGCTACTGCTACCACCAAATCTTGTTTCTCTTTGAGCCATATGACTCTTAGCCTTGGCATCTTCACCGGCATGGAGTGTTCCACGTGTCTGCGGCTTCAGCAGTGGGCTAGAGTCGGGTTCCATTTCATTTATCAGTTTGTGTCTCTTGTTTTGACCTACAGGCATCAGCCGTGAAGACGCGGGTGTAGTAGAAGCTGCTGGTCCAGCAAAAGAAATG</gDNA_template>
            <first_frame> F  L  F  F  L  Q  I  T  S  S  P  G  *  V  N  G  R  E  S  S  C  W  L  S  S  R  L  L  L  P  P  N  L  V  S  L  *  A  I  *  L  L  A  L  A  S  S  P  A  W  S  V  P  R  V  C  G  F  S  S  G  L  E  S  G  S  I  S  F  I  S  L  C  L  L  F  *  P  T  G  I  S  R  E  D  A  G  V  V  E  A  A  G  P  A  K  E  M </first_frame>
            <second_frame>  F  F  S  F  C  K  *  Q  A  P  R  D  E  *  M  G  V  N  H  P  V  G  *  A  P  G  Y  C  Y  H  Q  I  L  F  L  F  E  P  Y  D  S  *  P  W  H  L  H  R  H  G  V  F  H  V  S  A  A  S  A  V  G  *  S  R  V  P  F  H  L  S  V  C  V  S  C  F  D  L  Q  A  S  A  V  K  T  R  V  *  *  K  L  L  V  Q  Q  K  K   </second_frame>
            <third_frame>   S  F  L  F  A  N  N  K  L  P  G  M  S  E  W  A  *  I  I  L  L  A  K  L  P  A  T  A  T  T  K  S  C  F  S  L  S  H  M  T  L  S  L  G  I  F  T  G  M  E  C  S  T  C  L  R  L  Q  Q  W  A  R  V  G  F  H  F  I  Y  Q  F  V  S  L  V  L  T  Y  R  H  Q  P  *  R  R  G  C  S  R  S  C  W  S  S  K  R  N  </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <orf_entry>
              <id_line>
                <gDNA id="C01HBa0034P21.2" strand="+"/>
                <serials PGL_serial="2" AGS_serial="1" PPS_serial="1"/>
                <orf_info>
                  <exon_boundaries>
                    <exon start="98587" stop="98784"/>
                  </exon_boundaries>
                  <frame>2</frame>
                  <number_coding_nucleotides>195</number_coding_nucleotides>
                  <number_encoded_amino_acids>65</number_encoded_amino_acids>
                </orf_info>
              </id_line>
              <predicted_protein_sequence>IILLAKLPATATTKSCFSLSHMTLSLGIFTGMECSTCLRLQQWARVGFHFIYQFVSLVLTYRHQP*</predicted_protein_sequence>
            </orf_entry>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
  </PGL_module>
</GTH_output>
<!--
$ general statistics:
$ 8 chains have been computed
$ 
$ memory statistics:
$ 4080 bytes spliced alignments in total
$ 2 spliced alignments have been stored
$ 2040 bytes was the average size of a spliced alignment
$ 6704 bytes predicted gene locations in total
$ 2 predicted gene locations have been stored
$ 3352 bytes was the average size of a predicted gene location
$ 0 megabytes was the average size of the backtrace matrix
$ 9 backtrace matrices have been allocated
$ 
$ date finished: 2009-12-03 20:30:09
-->
