/data/tool/gcphrap aa.fasta.screen -ace -view -exp /data/ultra_disk/people/tomato/t1/C03HBa0166b15/workdir/all.assembly 
gcphrap version 0.990319

Run date:time  090227:124333
Query file(s):  aa.fasta.screen
Presumed sequence type: DNA

Pairwise comparison algorithm: banded Smith-Waterman

Score matrix (set by value of penalty: -2)
    A   C   G   T   N   X
A   1  -2  -2  -2   0  -3
C  -2   1  -2  -2   0  -3
G  -2  -2   1  -2   0  -3
T  -2  -2  -2   1   0  -3
N   0   0   0   0   0   0
X  -3  -3  -3  -3   0  -3

Gap penalties: gap_init: -4, gap_ext: -3, ins_gap_ext: -3, del_gap_ext: -3, 
Using complexity-adjusted scores. Assumed background frequencies:
 A: 0.250  C: 0.250  G: 0.250  T: 0.250  N: 0.000  X: 0.000  

minmatch: 14, maxmatch: 30, max_group_size: 20, minscore: 30, bandwidth: 14, indexwordsize: 10
vector_bound: 80
word_raw: 0
trim_penalty: -2, trim_score: 20, trim_qual: 13, maxgap: 30
repeat_stringency: 0.950000
qual_show: 20
confirm_length: 8, confirm_trim: 1, confirm_penalty: -5, confirm_score: 30
node_seg: 8, node_space: 4
forcelevel: 0
max_subclone_size: 5000

Sequence file: aa.fasta.screen    966 entries
Residue counts:
  A    281224
  C    155509
  G    165054
  N     2219
  T    276811
  X    163390
Total  1044207

Read name analysis:
 # Reads      # templates
   1           966

 Suffix counts:
(no suffix) 966


Templates inferred from description field:     0
Templates inferred from name field:          966

Read-template multiplicity analysis:
 # Reads      # templates
   1           966

Chemistries inferred from description field:
    0  dye-primer
    0  old-dye-terminator
    0  big-dye-terminator
    0  other

Chemistries inferred from name:
  966  dye-primer
    0  old-dye-terminator
    0  big-dye-terminator
    0  other

Directions inferred from description field:
    0  fwd
    0  rev
    0  unknown (set to fwd)

Directions inferred from name:
    0  fwd
    0  rev
  966  unknown (set to fwd)

Quality file: aa.fasta.screen.qual

Input quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 56  312746  30.0  312746  30.0    0.79
 51   85699   8.2  398445  38.2    1.47
 50   23051   2.2  421496  40.4    1.70
 48    5602   0.5  427098  40.9    1.79
 47    4241   0.4  431339  41.3    1.87
 46   12853   1.2  444192  42.5    2.19
 45   18822   1.8  463014  44.3    2.79
 44   16339   1.6  479353  45.9    3.44
 43   16948   1.6  496301  47.5    4.29
 42   32553   3.1  528854  50.6    6.34
 41    3858   0.4  532712  51.0    6.65
 40   45260   4.3  577972  55.4   11.17
 39    2590   0.2  580562  55.6   11.50
 38    1601   0.2  582163  55.8   11.75
 37   12216   1.2  594379  56.9   14.19
 36    1370   0.1  595749  57.1   14.54
 35    9817   0.9  605566  58.0   17.64
 34    7557   0.7  613123  58.7   20.65
 33    5505   0.5  618628  59.2   23.41
 32    8431   0.8  627059  60.1   28.73
 31    4319   0.4  631378  60.5   32.16
 30    2541   0.2  633919  60.7   34.70
 29   16548   1.6  650467  62.3   55.53
 28    4184   0.4  654651  62.7   62.16
 27    6252   0.6  660903  63.3   74.64
 26    2347   0.2  663250  63.5   80.53
 25   13683   1.3  676933  64.8  123.80
 24    7539   0.7  684472  65.5  153.82
 23    4995   0.5  689467  66.0  178.85
 22    6082   0.6  695549  66.6  217.22
 21    6940   0.7  702489  67.3  272.35
 20    6312   0.6  708801  67.9  335.47
 19   10652   1.0  719453  68.9  469.57
 18    8011   0.8  727464  69.7  596.54
 17    6997   0.7  734461  70.3  736.15
 16    8259   0.8  742720  71.1  943.60
 15   12277   1.2  754997  72.3  1331.84
 14   10140   1.0  765137  73.3  1735.52
 13   15654   1.5  780791  74.8  2520.07
 12   15860   1.5  796651  76.3  3520.77
 11   24632   2.4  821283  78.7  5477.36
 10   33823   3.2  855106  81.9  8859.66
  9   59633   5.7  914739  87.6  16367.01
  8   51531   4.9  966270  92.5  24534.13
  7   29945   2.9  996215  95.4  30508.94
  6   37083   3.6  1033298  99.0  39823.77
  4    8362   0.8  1041660  99.8  43152.74
  0    2413   0.2  1044073 100.0  45565.74
 -1     134   0.0  1044207 100.0  45699.74   (quality -1 = terminal quality 0)

Avg. full length: 1081.0, trimmed (qual > -1): 1080.8
Avg. quality: 35.3 per base

Exact duplicate reads:  None.

Probable unremoved sequencing vector (matches excluded from assembly, quality reduced to 0): 
aa110109f1   18-26   CTGCAGCCC
aa110109r1   17-50   GGTGGCGGCCGCTCTANGAACTAGTGGATCCCCC
ab060109r1   10-48   CCCGACGCGTGGCGGCCGCTCTAGACTAGTGGATCCCCC
ac010109f1   23-32   CTGCAGCCCN
ac010109r1   12-48   CGCGGGTGGCGGCCGCTCTAGANACTAGTGGATCCCC
ad010109f1   17-24   CTGCAGCC
ad010109r1   16-46   GGTGGCGGCCGCTCTAGACTAGTGGATCCCC
ad030109r1    5-46   GGATCACGGCGGGTGGCGGCCGCTCTAGACTAGTGGATCCCC
ad090109f1   17-25   CCTGCAGCC
ad120109r1    2-43   GTAAACTCCGCCGGTGGCCGGCGCTCTAGACTAGTGAGTCCC
af010109r1    9-48   CCCCGTCGGTTGGCGGCCGCTCTAGAATAGTGGATCCCCC
af100109r1    1-49   GGGGGGAATCCCGCGGGTGGCGGCCGCTCTAGAACTAGATGGATCCCCC
af120109r1   19-49   GTGGCGGCCGCTCTAGAATAGTGGATCCCCC
ah090109r1   11-47   CGCGGGTGGCGGCCGCTCTAGTAACTAGTGGATCCCC
ba050109f1    6-25   GGATCGAATTCCTGCAGCCC
ba050109r1   11-48   CCCGNCTGGTGGCGGCCGCTCTAGACTAGTGGATCCCC
bb070109r1   10-50   CCCGACGGGTGGCGGCCGCTCTAGAACTAGTGGGATCCCCC
bb090109f1   16-27   TCCCTGCAGCCC
bb110109f1   23-25   CCC
bc010109f1   15-22   CTGCAGCC
bc090109r1   50-51   TG
bd120109r1   50-51   TG
bf100109r1    1-39   GGGAAATCCCGCGGGTGGCGGCCGCTCTAGAACTAGTGG
bg030109r1   11-51   CCCGTCGGTGGGCGGCCGCTCTAGAACTAGTGGGATCCCCC
bh030109f1    1-23   AAAAGAATCGAATCCTGCAGCCC
bh030109r1   20-51   TGGCGGCCGCTCTAGAACTAGTGGGATCCCCC
bh070109f1   14-29   CGAATTCTTGCAGCCT
bh070109r1   14-46   CGGGTGGCGGCCGCTCTAGACTAGTGGATCCCC
bh080109r1    5-48   AACCCCCGCCGGTGGCGGCCGCTCTAGAAACTAGTGGATCCCCC
ca030109f1    6-24   GGATGNAATTNCTGCAGCC
ca070109r1    3-44   GGACCACGTCGGGTGGCGGCCGCTCTAGACTAGTGGATCCCC
cb010109f1   16-24   CTGCAGCCT
cb020109f1    9-19   GAATTCTGCAG
cb030109f1   10-21   GAATTNCTGCAG
cb030109r1    1-45   GGGGAATCCCGTCGGTGGCGGCCGCTCTAGAACTAGTGGTCCCCC
cc030109r1    3-44   GGCCCCCGTCGGGTGGCGGCCGCTCTAGAACTAGTGGACCCC
cd020109r1    4-48   AACCCCGGCGNGGGGCGGCCGCTCTANGAACTAGTGGATCCCCCA
cd080109f1    7-24   ATCGAATNCNTGCAGCCC
cd080109r1    7-49   CCGNNCGGTGGCGGCCGCTCTANGAACTAGTGGATCCCCCCTC
cd100109r1    5-46   GACCCCGTCGCGTGGCGGCCGCTCTAGAACTAGTGGACCCCC
ce020109r1    2-43   GGCCCCCGGCGGGTGGCGGCCGCTCTAGACTAGTGGACCCCC
ce110109r1   44-46   CCC
cf010109r1   10-47   CCGGCGGGTGGCGGCCGCTCTAGAACTAGTGGTCCCCC
cf040109f1   13-23   TCCCTGCAGCC
cf070109r1    3-45   GGACCCCGGCCGGTGGCGGCCGCTCTAGAACTAGTGGACCCCC
cf120109r1    6-46   ACCCCGTCGTGTGGCGGCCGCTCTAGAACTAGTGGACCCCC
cg030109f1   12-25   TTCTGCAGCCAGTT
cg030109r1    1-44   GGGACCCCGCCGGGTGGCGGCCGCTCTAGAACTAGTGGACCCCC
cg060109r1    1-46   GGGGGACCCCGGCGGGTGGCGGCCGCTCTAGAACTAGTGGTCCCCC
ch100109f1    4-22   AATTATCGAATCTGCAGCC
da040109f1   14-22   CTGCAGCCC
db040109f1    6-24   GATCGNAATTCCTGCAGCC
db070109r1    7-47   CCGGNCGGTGGCGGCCGCTCTACGAACTAGTGGATCCCCNC
dc040109f1    3-26   AAAAGAATCGTATTCCTGCAGCCC
dc040109r1   18-47   TGGCGGCCGCTCTAGAACTAGTGGTCCCCC
dc090109r1   10-45   CGNNCGGTGGCGGCCGCTCTAGAACTAGTGGACCCC
dc120109f1   22-24   ATT
dd040109f1   22-24   CCC
dd090109r1    3-46   GGGAACACGNCGGGTGGCGGCCGCTCTAGAACTAGTGGTCCCCC
dd120109r1   15-44   GTGGCGGCCGCTCTAGAACTAGTGGTCCCC
de080109f1    1-20   AATTATGAATTCTGCAGCCC
df010109r1   47-48   AN
df050109r1    9-46   CCGGCGGGTGGCGGCCGCTCTAGAACTAGTGGTCCCCC
dg010109r1    2-44   GGGAATCCGNCGGTGGCGGCCGCTCTAGAACTAGTGGTCCCCC
dg020109f1   11-21   TTCTGCAGCCC
dg020109r1    3-46   GGGACCCCGTCAGGTGGCGGCCGCTCTAGAACTAGTGGACCCCC
dg040109f1    7-24   ATCGAATTCCTGCAGCCC
dg040109r1    9-48   CCGNCGGGTGGCGGCCGCTCTANGAACTAGTGGATCCCCC
dg090109f1   15-23   CTGCAGCCC
dg090109r1   16-49   GGTGGCGGCCGCTCTAGAACTAGTGGGATCCCCC
dh040109r1    1-51   GGGGGGAACCCCCGGCGGGGGGCGGCCGCTCTAGAACTAGATGGATCCCNC
dh080109f1   11-27   CGAATNCNTGCAGCCNN
dh080109r1   13-45   CGNGTGGCGGCCGCTCTAGAACTAGTGGTCCCC
ea030109f1    7-23   ATCGAATTCTGCAGCNC
ea030109r1    7-44   CCCGTCGNGTGGCGGCCGCTCTAGAACTAGTGGTCCCC
ea060109r1    8-46   CCCGTTCGGTGGCGGCCGCTCTAGAACTAGTGGTCCCCC
ea120109r1    8-46   CCCGGCGGGTGGCGGCCGCTCTAGAACTAGTGGTCCCCC
eb020109r1   41-43   CCC
eb030109f1   22-22   C
eb040109r1    9-48   CGTACGGTGGCGGCCGCTCTAGAACTAGTGGGATCCCCGC
ec060109f1   16-23   CCTGCAGC
ed070109f1   14-21   CTGCAGCC
ed080109r1    2-43   GTAAACCCCGTCGGTGGCGGCCGCTCTAGAACTAGTGGACCC
ee110109r1   41-44   CCCC
ef020109f1    7-26   GATCGNAATTCGTGCAGCCC
ef030109r1    3-45   GGACCCCGTCGGGTGGCGGCCGCTCTAGAACTAGTGGACCCCC
eg060109r1    8-46   CCCCGCGGGTGGCGGCCGCTCTAGAACTAGTGGTCCCCC
eg070109r1    8-46   CCCGTCGNGTGGCGGCCGCTCTAGAACTAGTGGACCCCC
eg080109r1    1-47   GGGGAGATCACGTCGGGTGGCGGCCGCTCTAGAACTAGTGGTCCCCC
eh020109r1    2-41   GGGGAATCCCGCCGGGTGGCGGCCGCTCTAGAACTAGTGG
eh080109r1    9-46   CCGCCGGGTGGCGGCCGCTCTAGAACTAGTGGTCCCCC

Near duplicate reads: 
aa110109f1            dg090109f1      (imperfect: 17-1019 (19)   14-1010 (20) )
aa110109r1            dg090109r1      (imperfect: 16-1022 (11)   15-1023 (19) )
ac010109f1            ad010109f1      (imperfect: 22-1062 (4)   16-1058 (1) )
ac120109f1            cc050109r1      (imperfect: 47-1037 (0)   44-1029 (22) )
ad090109f1            ec060109f1      (imperfect: 16-1079 (0)   15-1069 (5) )
ad090109r1            ec060109r1      (imperfect: 49-1066 (0)   48-1071 (8) )
ae010109f1            eb040109r1      (imperfect: 44-1020 (0)   48-1032 (32) )
af010109r1            eg060109r1      (imperfect: 8-1036 (18)   7-1030 (19) )
af120109r1            dd120109r1      (imperfect: 18-1013 (14)   14-1012 (6) )
ba050109f1            ca030109f1      (imperfect: 5-1031 (37)   5-1034 (15) )
ba070109f1            cc110109r1      (imperfect: 45-1014 (47)   41-1004 (0) )
ba080109f1            de080109f1      (imperfect: 25-1033 (31)   34-1040 (0) )
ba080109r1            de080109r1      (imperfect: 46-1054 (16)   46-1056 (4) )
ba080109r1            ch100109r1      (imperfect: 46-1045 (25)   46-1043 (4) )
bb090109f1            cf040109f1      (imperfect: 15-1056 (4)   12-1049 (0) )
bb090109r1            cf040109r1      (imperfect: 44-1044 (8)   45-1044 (0) )
bb120109f1            dg120109f1      (imperfect: 38-1025 (0)   32-1017 (8) )
bb120109f1            db110109r1      (imperfect: 48-1000 (25)   46-996 (6) )
c03hba0166b15_sp601       c03hba0166b15_sp603 (imperfect: 10-961 (4)   13-959 (0) )
c03hba0166b15_sp601       c03hba0166b15_sp602 (imperfect: 10-923 (42)   11-918 (0) )
c03hba0166b15_sp602       c03hba0166b15_sp603 (imperfect: 10-918 (0)   12-930 (29) )
ca030109f1            ea030109f1      (imperfect: 29-1043 (6)   23-1036 (10) )
ca040109r1            ch080109r1      (imperfect: 49-1029 (8)   44-1025 (0) )
ca060109f1            eh060109f1      (imperfect: 32-1044 (2)   28-1033 (0) )
cb070109f1            ce120109f1      (imperfect: 21-1013 (21)   28-1018 (1) )
cb100109f1            cc110109f1      (imperfect: 21-1001 (18)   26-1004 (0) )
cc030109r1            ce020109r1      (imperfect: 2-1047 (4)   1-1033 (15) )
cd080109f1            dg040109f1      (imperfect: 6-1034 (8)   6-1034 (0) )
cd080109r1            dg040109r1      (imperfect: 6-1030 (18)   8-1034 (0) )
cg030109f1            dg020109f1      (imperfect: 11-1008 (17)   10-1013 (1) )
cg030109r1            dg020109r1      (imperfect: 0-1025 (10)   2-1028 (2) )
cg070109f1            dc110109r1      (imperfect: 49-1017 (13)   44-1012 (0) )
ch020109f1            ec050109r1      (imperfect: 47-1022 (3)   46-1024 (45) )
ch100109f1            de080109f1      (imperfect: 3-1034 (3)   0-1034 (6) )
ch100109r1            de080109r1      (imperfect: 45-1047 (0)   45-1051 (9) )
da040109f1            ed070109f1      (imperfect: 13-1046 (0)   13-1049 (8) )
db110109r1            dg120109f1      (imperfect: 46-1002 (0)   42-999 (26) )
dc090109r1            eb040109r1      (imperfect: 9-1037 (0)   8-1032 (32) )

Internal read matches (same orientation) : 
 31   aa050109r1    tandem (31-mer)_2    474-546 
 39   aa050109r1    disjoint 82-mers  567-648 / 774-856 
 70   ab070109f1    tandem (72-mer)_3    305-543 
 31   ab120109f1    tandem (31-mer)_2    447-519 
 39   ab120109f1    disjoint 82-mers  540-621 / 747-829 
 70   ac010109f1    tandem (72-mer)_3    191-429 
 52   ac030109r1    tandem (43-mer)_2    276-382 
 67   ac050109r1    tandem (84-mer)_2    632-801 
 70   ad010109f1    tandem (72-mer)_3    181-419 
125   ad070109f1    tandem (144-mer)_2    171-522 
114   ad090109f1    tandem (146-mer)_2     25-330 
124   ae020109r1    tandem (137-mer)_2    577-928 
 52   ae060109f1    tandem (43-mer)_2    185-291 
 34   ae100109f1    disjoint 50-mers  830-879 / 892-941 
 33   af030109f1    tandem (46-mer)_2    174-267 
 82   af040109r1    disjoint 219-mers  347-565 / 605-814 
112   af080109r1    tandem (144-mer)_2    706-1016 
 65   af120109f1    tandem (85-mer)_1    213-382 
 50   ag030109f1    disjoint 105-mers  571-675 / 829-934 
 66   ag030109r1    disjoint 154-mers  136-289 / 386-547 
 52   ag040109r1    tandem (43-mer)_2    517-623 
 31   ah050109f1    tandem (31-mer)_2    327-399 
 39   ah050109f1    disjoint 82-mers  420-501 / 627-709 
 38   ah050109r1    disjoint 83-mers  515-597 / 723-804 
 85   ah070109r1    tandem (137-mer)_2    136-456 
199   ba040109f1    disjoint 255-mers  61-315 / 323-577 
 52   bb040109f1    tandem (43-mer)_2    120-226 
 65   bb040109r1    tandem (85-mer)_1    761-930 
 65   bc090109r1    tandem (85-mer)_1     88-257 
205   bc100109f1    disjoint 255-mers  338-592 / 600-854 
 38   bd090109f1    disjoint 83-mers  480-562 / 688-769 
 67   bd100109f1    disjoint 105-mers  481-585 / 739-842 
 61   bd120109r1    tandem (85-mer)_1     89-258 
 33   be110109f1    tandem (46-mer)_2    396-489 
 70   bf020109f1    tandem (72-mer)_3    251-489 
 33   bf040109f1    disjoint 57-mers  368-424 / 503-559 
 37   bf100109r1    tandem (37-mer)_2    764-872 
 70   bf120109r1    tandem (73-mer)_3    575-813 
 32   bg070109f1    disjoint 55-mers  716-770 / 778-832 
 70   bg120109r1    tandem (72-mer)_3    568-806 
189   bh020109f1    disjoint 254-mers  64-317 / 325-579 
 32   ca080109r1    disjoint 55-mers  580-634 / 642-696 
205   cb070109r1    disjoint 255-mers  260-514 / 522-776 
 33   cc090109r1    tandem (46-mer)_2    880-973 
 84   cd080109f1    disjoint 210-mers  337-546 / 586-804 
 67   cd080109r1    disjoint 105-mers  659-763 / 917-1020 
 70   cd120109f1    tandem (72-mer)_3    459-697 
127   ce010109r1    tandem (137-mer)_2    227-578 
 32   ce090109r1    disjoint 55-mers  376-430 / 438-492 
125   cf020109f1    tandem (144-mer)_2    248-599 
 52   cf110109f1    tandem (43-mer)_2     55-161 
 31   cf120109r1    disjoint 90-mers  46-135 / 256-343 
 37   cg110109f1    tandem (37-mer)_2    587-695 
201   da080109f1    disjoint 255-mers  470-724 / 732-986 
 52   da090109f1    tandem (43-mer)_2    165-271 
205   da100109f1    disjoint 255-mers  148-402 / 410-664 
 65   da110109f1    tandem (85-mer)_1    298-467 
 31   db040109f1    tandem (31-mer)_2    621-693 
 52   db070109r1    tandem (43-mer)_2    307-413 
125   db120109f1    tandem (144-mer)_2    597-948 
 37   dc080109f1    tandem (37-mer)_2    336-444 
 33   dd020109r1    disjoint 57-mers  472-528 / 607-663 
 59   dd040109r1    disjoint 105-mers  686-790 / 944-1049 
 32   dd050109f1    disjoint 55-mers  221-275 / 283-337 
 94   dd080109f1    tandem (137-mer)_2    599-935 
 67   dd110109r1    tandem (84-mer)_2    520-689 
 37   df030109r1    tandem (37-mer)_2    781-889 
 34   df120109r1    disjoint 163-mers  64-226 / 278-434 
205   dg030109f1    disjoint 255-mers  71-325 / 333-587 
 84   dg040109f1    disjoint 210-mers  337-546 / 586-804 
 53   dg040109r1    disjoint 105-mers  661-765 / 919-1024 
 31   dg080109r1    tandem (TATG)_16    186-253 
 67   dg110109r1    tandem (84-mer)_2    546-715 
 37   dh070109f1    tandem (37-mer)_2    128-236 
 32   dh110109r1    tandem (36-mer)_2     54-143 
 52   ea080109f1    tandem (43-mer)_2    152-258 
 31   eb090109r1    tandem (31-mer)_2    845-917 
 36   eb090109r1    disjoint 57-mers  115-171 / 250-306 
 37   eb110109r1    tandem (37-mer)_2    553-661 
 37   eb120109f1    tandem (37-mer)_2    635-743 
125   ec050109f1    tandem (144-mer)_2    336-687 
118   ec060109f1    tandem (144-mer)_2     23-326 
122   ec070109f1    tandem (144-mer)_2    635-982 
 36   ec120109f1    disjoint 57-mers  401-457 / 536-592 
 38   ec120109f1    disjoint 141-mers  44-184 / 252-398 
 33   ed040109f1    disjoint 57-mers  664-720 / 799-855 
 31   ee010109r1    disjoint 82-mers  148-229 / 355-436 
 32   ee020109f1    disjoint 55-mers  189-243 / 251-305 
 38   ee110109f1    disjoint 83-mers  544-626 / 752-833 
125   ef070109f1    tandem (144-mer)_2    235-586 
127   eg010109f1    tandem (137-mer)_2    272-623 
 70   eh050109f1    tandem (73-mer)_3    443-681 
 70   eh050109r1    tandem (72-mer)_3    647-885 
 32   eh120109f1    disjoint 55-mers  472-526 / 534-588 

No. of node-rejected pairs: 1.

Multi-segment reads (initially rejected segments in parentheses) -- XXX means segments flank X'd region: 
ab100109f1          (10 87)  87 189 
ab100109r1    XXX   50 211  (964 1072) 
ac010109r1    XXX   (12 48)  694 1060 
ac020109f1          (14 103)  269 830 
ac070109f1          (9 98)  102 1078 
ad010109r1    XXX   (16 46)  692 1056 
ad030109r1          (5 46)  49 642 
ae080109f1          (1 110)  112 912 
ae120109f1          (12 112)  113 1079 
af090109f1          (12 102)  103 974 
af100109r1          (1 49)  50 233 
af110109f1          (23 114)  115 936 
ag120109f1          (16 114)  114 1065 
ah030109f1          (8 103)  126 997 
ah040109f1          (1 109)  137 579 
ah070109r1          49 457  (524 897) 
bd020109f1          (27 118)  117 1008 
bd050109r1          49 973  (993 1081) 
bd060109f1          (25 153)  151 1058 
be040109f1          (32 79)  183 501 
bf060109f1    XXX   18 93  (1084 1135) 
bf100109r1          (1 39)  48 1019 
bh080109r1          (5 51)  49 1020 
ca060109r1          (48 432)  578 940 
cc010109f1          (48 93)  181 928 
cc080109r1          (338 668)  853 1041 
cc090109r1          (120 185)  470 1029 
cd020109r1          (4 50)  49 1028 
cf010109r1          (10 47)  48 305 
db020109r1          98 153  (375 847) 
dc100109f1          22 839  (840 1031) 
dd090109r1          (3 48)  47 420 
de120109r1          (107 874)  999 1056 
dg010109r1          (2 46)  45 407 
dh040109r1          (1 51)  60 232 
eb050109r1          (46 598)  745 1065 
eh020109r1          (2 41)  48 1019 
eh080109r1          (9 46)  47 314 

38 reads with multiple segments.

Probable deletion reads (excluded from assembly):

bf100109r1    84    39- 48  (  eh020109r1     41-134)

1 probable deletion reads.


Revised quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 90  590594  56.6  590594  56.6    0.00
 89     154   0.0  590748  56.6    0.00
 88     444   0.0  591192  56.6    0.00
 87     226   0.0  591418  56.6    0.00
 86     248   0.0  591666  56.7    0.00
 85     403   0.0  592069  56.7    0.00
 84     309   0.0  592378  56.7    0.00
 83     264   0.0  592642  56.8    0.00
 82     168   0.0  592810  56.8    0.00
 81    3057   0.3  595867  57.1    0.00
 80      78   0.0  595945  57.1    0.00
 79     107   0.0  596052  57.1    0.00
 78     124   0.0  596176  57.1    0.00
 77     102   0.0  596278  57.1    0.00
 76     854   0.1  597132  57.2    0.00
 75     168   0.0  597300  57.2    0.00
 74     109   0.0  597409  57.2    0.00
 73     291   0.0  597700  57.2    0.00
 72      72   0.0  597772  57.2    0.00
 71     252   0.0  598024  57.3    0.00
 70     138   0.0  598162  57.3    0.00
 69     222   0.0  598384  57.3    0.00
 68      85   0.0  598469  57.3    0.00
 67     281   0.0  598750  57.3    0.00
 66   12883   1.2  611633  58.6    0.00
 65    1035   0.1  612668  58.7    0.00
 64     148   0.0  612816  58.7    0.00
 63      46   0.0  612862  58.7    0.00
 62     283   0.0  613145  58.7    0.00
 61    2527   0.2  615672  59.0    0.01
 60     699   0.1  616371  59.0    0.01
 59     329   0.0  616700  59.1    0.01
 58     329   0.0  617029  59.1    0.01
 57     549   0.1  617578  59.1    0.01
 56    2595   0.2  620173  59.4    0.02
 55     587   0.1  620760  59.4    0.02
 54     790   0.1  621550  59.5    0.02
 53     454   0.0  622004  59.6    0.02
 52     577   0.1  622581  59.6    0.03
 51     731   0.1  623312  59.7    0.03
 50     703   0.1  624015  59.8    0.04
 49     481   0.0  624496  59.8    0.05
 48     448   0.0  624944  59.8    0.05
 47     369   0.0  625313  59.9    0.06
 46     653   0.1  625966  59.9    0.08
 45     556   0.1  626522  60.0    0.09
 44     899   0.1  627421  60.1    0.13
 43     710   0.1  628131  60.2    0.17
 42     965   0.1  629096  60.2    0.23
 41     756   0.1  629852  60.3    0.29
 40   14890   1.4  644742  61.7    1.78
 39     125   0.0  644867  61.8    1.79
 38     123   0.0  644990  61.8    1.81
 37     256   0.0  645246  61.8    1.86
 36     165   0.0  645411  61.8    1.90
 35     330   0.0  645741  61.8    2.01
 34     435   0.0  646176  61.9    2.18
 33     399   0.0  646575  61.9    2.38
 32     362   0.0  646937  62.0    2.61
 31     203   0.0  647140  62.0    2.77
 30     121   0.0  647261  62.0    2.89
 29     263   0.0  647524  62.0    3.22
 28     148   0.0  647672  62.0    3.46
 27     256   0.0  647928  62.0    3.97
 26     144   0.0  648072  62.1    4.33
 25    1382   0.1  649454  62.2    8.70
 24     349   0.0  649803  62.2   10.09
 23     296   0.0  650099  62.3   11.57
 22     245   0.0  650344  62.3   13.12
 21     292   0.0  650636  62.3   15.44
 20     216   0.0  650852  62.3   17.60
 19     463   0.0  651315  62.4   23.43
 18     197   0.0  651512  62.4   26.55
 17     269   0.0  651781  62.4   31.92
 16     344   0.0  652125  62.5   40.56
 15     482   0.0  652607  62.5   55.80
 14     353   0.0  652960  62.5   69.85
 13     543   0.1  653503  62.6   97.07
 12     405   0.0  653908  62.6  122.62
 11     648   0.1  654556  62.7  174.09
 10     865   0.1  655421  62.8  260.59
  9    1126   0.1  656547  62.9  402.35
  8     914   0.1  657461  63.0  547.21
  7     697   0.1  658158  63.0  686.28
  6     373   0.0  658531  63.1  779.97
  5      31   0.0  658562  63.1  789.77
  4     149   0.0  658711  63.1  849.09
  3      46   0.0  658757  63.1  872.15
  2  127601  12.2  786358  75.3  81382.93
  0    3094   0.3  789452  75.6  84476.93
 -1  254755  24.4  1044207 100.0  339231.93   (quality -1 = terminal quality 0)

Avg. full length: 1081.0, trimmed (qual > -1): 817.2
Avg. quality: 54.3 per base

LLR score histogram:
Score    #   cum # 
-95.0  2358  2358
-90.0     4  2362
-85.0     9  2371
-80.0     5  2376
-75.0    28  2404
-70.0    10  2414
-65.0     4  2418
-60.0    14  2432
-55.0     4  2436
-50.0    11  2447
-45.0    13  2460
-40.0    13  2473
-35.0     5  2478
-30.0     6  2484
-25.0     1  2485
-20.0     4  2489
-15.0    94  2583
-10.0   209  2792
 -5.0   145  2937
  0.0  2754  5691
  5.0  2718  8409
 10.0  2324  10733
 15.0  2063  12796
 20.0   596  13392

LLR score histogram:
Score    #   cum # 
-95.0  2341  2341
-90.0    11  2352
-85.0     2  2354
-80.0     5  2359
-75.0    28  2387
-70.0    12  2399
-65.0    14  2413
-60.0     6  2419
-55.0     3  2422
-50.0    10  2432
-45.0    18  2450
-40.0    12  2462
-35.0     9  2471
-30.0     8  2479
-25.0     4  2483
-20.0     4  2487
-15.0    98  2585
-10.0   227  2812
 -5.0   126  2938
  0.0  2747  5685
  5.0  2722  8407
 10.0  2325  10732
 15.0  2063  12795
 20.0   597  13392

2d revised quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 90  588029  56.3  588029  56.3    0.00
 89     219   0.0  588248  56.3    0.00
 88     512   0.0  588760  56.4    0.00
 87     242   0.0  589002  56.4    0.00
 86     319   0.0  589321  56.4    0.00
 85     509   0.0  589830  56.5    0.00
 84     352   0.0  590182  56.5    0.00
 83     280   0.0  590462  56.5    0.00
 82     199   0.0  590661  56.6    0.00
 81    3173   0.3  593834  56.9    0.00
 80     122   0.0  593956  56.9    0.00
 79     138   0.0  594094  56.9    0.00
 78     139   0.0  594233  56.9    0.00
 77     124   0.0  594357  56.9    0.00
 76     830   0.1  595187  57.0    0.00
 75     203   0.0  595390  57.0    0.00
 74     135   0.0  595525  57.0    0.00
 73     303   0.0  595828  57.1    0.00
 72      91   0.0  595919  57.1    0.00
 71     415   0.0  596334  57.1    0.00
 70     144   0.0  596478  57.1    0.00
 69     237   0.0  596715  57.1    0.00
 68     100   0.0  596815  57.2    0.00
 67     277   0.0  597092  57.2    0.00
 66   13479   1.3  610571  58.5    0.00
 65    1025   0.1  611596  58.6    0.00
 64     161   0.0  611757  58.6    0.00
 63      54   0.0  611811  58.6    0.00
 62     287   0.0  612098  58.6    0.00
 61    2723   0.3  614821  58.9    0.01
 60     716   0.1  615537  58.9    0.01
 59     341   0.0  615878  59.0    0.01
 58     327   0.0  616205  59.0    0.01
 57     561   0.1  616766  59.1    0.01
 56    2760   0.3  619526  59.3    0.02
 55     641   0.1  620167  59.4    0.02
 54     777   0.1  620944  59.5    0.02
 53     455   0.0  621399  59.5    0.02
 52     634   0.1  622033  59.6    0.03
 51     747   0.1  622780  59.6    0.03
 50     740   0.1  623520  59.7    0.04
 49     493   0.0  624013  59.8    0.05
 48     466   0.0  624479  59.8    0.06
 47     402   0.0  624881  59.8    0.06
 46     665   0.1  625546  59.9    0.08
 45     569   0.1  626115  60.0    0.10
 44     946   0.1  627061  60.1    0.14
 43     723   0.1  627784  60.1    0.17
 42    1023   0.1  628807  60.2    0.24
 41     756   0.1  629563  60.3    0.30
 40   14753   1.4  644316  61.7    1.77
 39     150   0.0  644466  61.7    1.79
 38     138   0.0  644604  61.7    1.81
 37     284   0.0  644888  61.8    1.87
 36     184   0.0  645072  61.8    1.92
 35     348   0.0  645420  61.8    2.03
 34     458   0.0  645878  61.9    2.21
 33     416   0.0  646294  61.9    2.42
 32     383   0.0  646677  61.9    2.66
 31     207   0.0  646884  61.9    2.82
 30     127   0.0  647011  62.0    2.95
 29     286   0.0  647297  62.0    3.31
 28     168   0.0  647465  62.0    3.58
 27     265   0.0  647730  62.0    4.10
 26     155   0.0  647885  62.0    4.49
 25    1524   0.1  649409  62.2    9.31
 24     351   0.0  649760  62.2   10.71
 23     300   0.0  650060  62.3   12.21
 22     252   0.0  650312  62.3   13.80
 21     294   0.0  650606  62.3   16.14
 20     228   0.0  650834  62.3   18.42
 19     475   0.0  651309  62.4   24.40
 18     199   0.0  651508  62.4   27.55
 17     282   0.0  651790  62.4   33.18
 16     349   0.0  652139  62.5   41.95
 15     491   0.0  652630  62.5   57.47
 14     365   0.0  652995  62.5   72.00
 13     573   0.1  653568  62.6  100.72
 12     427   0.0  653995  62.6  127.66
 11     662   0.1  654657  62.7  180.25
 10     877   0.1  655534  62.8  267.95
  9    1191   0.1  656725  62.9  417.89
  8     936   0.1  657661  63.0  566.23
  7     772   0.1  658433  63.1  720.27
  6     397   0.0  658830  63.1  819.99
  5     109   0.0  658939  63.1  854.46
  4     238   0.0  659177  63.1  949.21
  3     138   0.0  659315  63.1  1018.37
  2  127043  12.2  786358  75.3  81177.08
  0    3094   0.3  789452  75.6  84271.08
 -1  254755  24.4  1044207 100.0  339026.08   (quality -1 = terminal quality 0)

Avg. full length: 1081.0, trimmed (qual > -1): 817.2
Avg. quality: 54.3 per base

No. confirmed reads: 809
Avg. length: 1057.9, confirmed: 842.5, str. confirmed: 826.5, trimmed: 867.3
Preliminary clone size estimate: 52753 bp, depth of coverage: 12.9

Depth histogram (max_depth, #reads, cum #reads):

25   168     168
24    17     185
23    10     195
22    15     210
21    26     236
20    34     270
19    49     319
18    10     329
17    43     372
16    47     419
15    32     451
14    54     505
13    60     565
12    51     616
11    38     654
10    40     694
 9    28     722
 8    13     735
 7    16     751
 6     4     755
 5    14     769
 4     8     777
 3     8     785
 2     9     794
 1    15     809
 0   156     965

Forward confirmed bases: 0

Substitutions by nucleotide:
       A      C      G      T      N      X      Z    Total
A      0      0      0      0      0      0      0        0
C      0      0      0      0      0      0      0        0
G      0      0      0      0      0      0      0        0
T      0      0      0      0      0      0      0        0
N      0      0      0      0      0      0      0        0
X      0      0      0      0      0      0      0        0
Z      0      0      0      0      0      0      0        0

Substitutions by quality: 
       Total

Histogram of spacings between adjacent indel pairs:


Reverse confirmed bases: 0

Substitutions by nucleotide:
       A      C      G      T      N      X      Z    Total
A      0      0      0      0      0      0      0        0
C      0      0      0      0      0      0      0        0
G      0      0      0      0      0      0      0        0
T      0      0      0      0      0      0      0        0
N      0      0      0      0      0      0      0        0
X      0      0      0      0      0      0      0        0
Z      0      0      0      0      0      0      0        0

Substitutions by quality: 
       Total

Histogram of spacings between adjacent indel pairs:


Blocked reads: 
aa100109r1 49 334   right
ab100109r1 49 226   right
ac100109r1 99 430   right
ac110109r1 49 130   right
ad030109r1 49 648   right
ad060109r1 49 300   right
ae070109r1 46 109   right
ae090109r1 47 331   right
ae110109r1 52 420   right
af070109r1 49 306   right
af100109r1 49 235   right
af110109f1 66 775  left 
ag120109f1 66 854  left 
ba040109r1 329 803  left 
ba100109f1 26 182   right
bb010109r1 48 499   right
bc020109r1 56 567   right
bc110109r1 49 156   right
bc120109r1 52 291   right
bd080109r1 48 630   right
be010109f1 25 92   right
bf060109r1 44 126   right
bf080109r1 53 108   right
ca010109r1 44 759   right
ca050109r1 45 336   right
ca110109r1 46 94   right
cb010109f1 25 176   right
cb040109r1 45 256   right
cc080109r1 232 270  left 
cc090109r1 80 941  left 
ce040109f1 31 74   right
ce040109r1 69 114   right
ce050109r1 50 98   right
cf010109r1 47 307   right
db020109f1 267 882  left 
db090109r1 46 441   right
dc060109f1 40 67   right
dc060109r1 50 108   right
dd090109r1 46 424   right
de030109r1 52 348   right
df050109r1 46 794   right
dg010109r1 44 413   right
dh040109r1 100 236   right
ea070109f1 26 192   right
ea120109f1 80 944  left 
eb060109r1 63 198   right
ed050109r1 46 534   right
ed110109r1 49 552   right
eh010109r1 43 427   right
eh080109r1 46 320   right

50 blocked reads: 7 left only, 43 right only, 0 both.
27 reads (not shown) lack a high-quality segment.
Bypassed reads: ce020109r1 cc030109r1
Bypassed reads:  bc120109r1
Bypassed reads:  eh100109r1
Bypassed reads:  dg010109r1
Bypassed reads:  ed110109r1
Bypassed reads:  ae090109r1
Bypassed reads:  eb060109r1
Bypassed reads:  ae070109r1
Bypassed reads:  ce040109r1

0 perfect duplicates

144 isolated singletons (having no non-vector match to any other read): 
  Read         Length      (# trimmed non-X bases)
 ch030109r1    1023   (0)
 ch030109f1    1027   (0)
 cg060109f1    1033   (0)
 cf100109f1    1049   (0)
 ce070109r1    1012   (0)
 cf030109f1    1029   (0)
 cf030109r1    1042   (0)
 cf070109f1    1034   (0)
 da050109f1    1056   (0)
 dc070109f1    1032   (0)
 dc070109r1    2088   (0)
 dd030109r1    1039   (0)
 de060109f1    1035   (870)
 dc010109r1    1047   (0)
 da050109r1    1058   (0)
 da060109f1    1033   (0)
 da060109r1    1041   (0)
 dc010109f1    1059   (0)
 ce070109f1    1039   (0)
 ca070109f1    1041   (0)
 ca100109f1    1007   (0)
 ca100109r1    1060   (0)
 cb010109r1    1100   (0)
 bh120109r1    1456   (0)
 bg060109f1    1082   (0)
 bg060109r1    1076   (0)
 bh050109r1    1680   (0)
 bh100109r1    1433   (0)
 cb020109r1    1034   (0)
 cc020109f1    1044   (0)
 cc020109r1    1052   (0)
 cc080109f1    1046   (0)
 cd100109f1    1047   (0)
 cc010109r1    1685   (0)
 cb060109f1    1061   (0)
 cb060109r1    1055   (0)
 cb090109f1    1156   (0)
 cb090109r1    1037   (0)
 de060109r1    1041   (766)
 ee050109r1    1624   (0)
 ee050109f1    1089   (0)
 ed120109r1    2178   (0)
 ed030109r1    1400   (0)
 ec080109r1    1043   (0)
 ed010109f1    1690   (0)
 ed010109r1    1429   (0)
 ed030109f1    1307   (0)
 ee120109f1    1149   (0)
 eg080109f1    1088   (0)
 eh070109f1    1024   (0)
 eh110109f1    1127   (0)
 eh110109r1    1092   (0)
 eg070109f1    1034   (0)
 ee120109r1    1103   (0)
 ef030109f1    1046   (0)
 eg050109f1    1519   (0)
 eg050109r1    1763   (0)
 ec080109f1    1048   (0)
 df080109f1    1067   (0)
 df080109r1    1071   (0)
 dh020109f1    1026   (0)
 dh020109r1    1026   (0)
 df060109r1    1045   (0)
 de110109f1    1032   (0)
 de110109r1    1037   (0)
 de120109f1    1020   (0)
 df060109f1    1055   (0)
 dh060109f1    1025   (0)
 ea110109f1    1041   (0)
 eb010109r1    1426   (0)
 ec020109r1    1077   (0)
 ec030109f1    2060   (0)
 ea070109r1    1084   (0)
 dh060109r1    1114   (0)
 dh090109r1    1019   (0)
 ea010109r1    1083   (0)
 ea060109f1    1037   (0)
 bh120109f1    1386   (0)
 af060109r1    1182   (0)
 af060109f1    1137   (0)
 af050109r1    1121   (0)
 af030109r1    1106   (0)
 ad110109f1    1084   (0)
 ad110109r1    1095   (0)
 ae040109f1    1088   (0)
 ae040109r1    1091   (0)
 ag020109f1    1041   (0)
 ah060109r1    1476   (0)
 ah090109f1    1081   (0)
 ah110109r1    1593   (0)
 ba090109f1    2436   (0)
 ah040109r1    1622   (0)
 ag020109r1    1067   (0)
 ah020109f1    1026   (0)
 ah020109r1    1034   (0)
 ah030109r1    1106   (0)
 ad100109r1    1108   (708)
 ab010109f1    1068   (0)
 aa120109r1    1031   (0)
 aa120109f1    1062   (0)
 aa090109r1    1088   (0)
 aa060109f1    1598   (0)
 aa060109r1    1068   (539)
 aa070109r1    1554   (0)
 aa090109f1    1078   (0)
 ab010109r1    1061   (0)
 ac060109f1    1410   (0)
 ac060109r1    1537   (0)
 ac110109f1    1049   (0)
 ad100109f1    1081   (726)
 ac040109r1    1153   (0)
 ab020109f1    1065   (0)
 ab110109f1    1043   (0)
 ab110109r1    1071   (0)
 ac040109f1    1130   (0)
 bg040109r1    1070   (0)
 be040109r1    1537   (0)
 be020109r1    1120   (0)
 be020109f1    1074   (0)
 be010109r1    1579   (0)
 bd040109f1    1150   (0)
 bd010109r1    1371   (0)
 bd010109f1    1325   (0)
 be090109f1    2123   (0)
 bg040109f1    1074   (0)
 bg030109f1    1054   (0)
 bf110109f1    1043   (0)
 bf090109r1    1124   (0)
 be090109r1    1414   (0)
 bf010109f1    1758   (0)
 bf010109r1    1188   (0)
 bf020109r1    1075   (0)
 bd120109f1    1623   (0)
 ba110109f1    1289   (0)
 ba110109r1    1307   (0)
 bb010109f1    1363   (0)
 bb030109f1    1688   (0)
 bb070109f1    1064   (0)
 bb030109r1    1313   (0)
 bb080109r1    1385   (0)
 ba100109r1    1053   (0)
 bc030109r1    1550   (0)
 bc030109f1    1704   (0)
 bc010109r1    1180   (0)

Contig 1.  1 read; 1060 bp (untrimmed), 818 (trimmed).
 ****  PROBABLE DELETION READ
      1  1060 bf100109r1   1034 (866)  0.00 0.00 0.00    0 (1060)    0 (1059) 

Contig quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 56     406  38.3     406  38.3    0.00
 51      90   8.5     496  46.8    0.00
 50      17   1.6     513  48.4    0.00
 48      11   1.0     524  49.4    0.00
 47       2   0.2     526  49.6    0.00
 46      19   1.8     545  51.4    0.00
 45      24   2.3     569  53.7    0.00
 44       5   0.5     574  54.2    0.00
 43      14   1.3     588  55.5    0.00
 42      27   2.5     615  58.0    0.01
 40      52   4.9     667  62.9    0.01
 39       1   0.1     668  63.0    0.01
 38       2   0.2     670  63.2    0.01
 37      10   0.9     680  64.2    0.01
 36       2   0.2     682  64.3    0.01
 35       5   0.5     687  64.8    0.02
 34       3   0.3     690  65.1    0.02
 33       6   0.6     696  65.7    0.02
 32       3   0.3     699  65.9    0.02
 31       1   0.1     700  66.0    0.02
 30       1   0.1     701  66.1    0.02
 29      12   1.1     713  67.3    0.04
 28       1   0.1     714  67.4    0.04
 27       6   0.6     720  67.9    0.05
 26       2   0.2     722  68.1    0.06
 25      11   1.0     733  69.2    0.09
 24       2   0.2     735  69.3    0.10
 23       6   0.6     741  69.9    0.13
 22       3   0.3     744  70.2    0.15
 21       7   0.7     751  70.8    0.20
 20       4   0.4     755  71.2    0.24
 19      11   1.0     766  72.3    0.38
 18       8   0.8     774  73.0    0.51
 17       3   0.3     777  73.3    0.57
 16       5   0.5     782  73.8    0.70
 15       6   0.6     788  74.3    0.89
 14       7   0.7     795  75.0    1.16
 13       4   0.4     799  75.4    1.36
 12       5   0.5     804  75.8    1.68
 11       3   0.3     807  76.1    1.92
 10       3   0.3     810  76.4    2.22
  9       2   0.2     812  76.6    2.47
  8       5   0.5     817  77.1    3.26
  7       1   0.1     818  77.2    3.46
 -1     242  22.8    1060 100.0  245.46   (quality -1 = terminal quality 0)

Avg. full length: 1060.0, trimmed (qual > -1): 818.0
Avg. quality: 36.1 per base

Initial, terminal qual 0 segments:  1-43, 862-1060

Regions of LLR- adjusted quality < 2.0:
1-44, 77-83, 116-118, 753-755, 765, 769, 791, 795, 
797, 799, 804-806, 817-821, 823-831, 833-847, 849-851, 854-1060, 


16 regions, avg size 19.1, avg spacing 66.2

First_start: 1060, last_end: 1

Reads with neg LLR score, or confirmed or high-qual unaligned seg > 20 bases, or other problem:

(Lngths init HQ, CF unalgn segs); aligned contig pos [LLR score]; (terminal HQ, CF unalgn); read id; aligned read pos
| confirmed read segments | unaligned read segments matching elsewhere
 (LU = local unaligned, DU = distant unaligned, DA = distant aligned, ** = overlaps trimmed region
 || Best local and distant LLR scores
(0, 0)     1- 1060 [18.2] (0,0)     bf100109r1         1-1060 | (1 39)  48 1019 | DA:(**48 1019**) || local(+/-) (0.0,0.0), distant (21.0,0.0)

Gaps in unique-read coverage:  None.

Contig 2.  1 read; 1091 bp (untrimmed), 0 (trimmed).
      1  1091 ab020109r1    102 ( 46)  0.00 0.00 0.00  984 (1091)    0 (1090) 

Contig quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 -1    1091 100.0    1091 100.0  1091.00   (quality -1 = terminal quality 0)

Avg. full length: 1091.0, trimmed (qual > -1): 0.0
Avg. quality: 0.0 per base

Initial, terminal qual 0 segments:  1-1091, (None)

Regions of LLR- adjusted quality < 2.0:
1-1091, 

1 regions, avg size 1091.0, avg spacing 1091.0

First_start: 1091, last_end: 1

Reads with neg LLR score, or confirmed or high-qual unaligned seg > 20 bases, or other problem:

(Lngths init HQ, CF unalgn segs); aligned contig pos [LLR score]; (terminal HQ, CF unalgn); read id; aligned read pos
| confirmed read segments | unaligned read segments matching elsewhere
 (LU = local unaligned, DU = distant unaligned, DA = distant aligned, ** = overlaps trimmed region
 || Best local and distant LLR scores
(0, 0)   985- 1091 [ 0.0] (0,0)     ab020109r1         985-1091 | 985 1090 | DA:(985 1090) || local(+/-) (0.0,0.0), distant (0.0,2.0)

Gaps in unique-read coverage:  None.

Contig 3.  1 read; 1068 bp (untrimmed), 0 (trimmed).
      1  1068 ah090109r1     45 (  0)  0.00 0.00 0.00    0 (1068) 1021 (1067) 

Contig quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 -1    1068 100.0    1068 100.0  1068.00   (quality -1 = terminal quality 0)

Avg. full length: 1068.0, trimmed (qual > -1): 0.0
Avg. quality: 0.0 per base

Initial, terminal qual 0 segments:  1-1068, (None)

Regions of LLR- adjusted quality < 2.0:
1-1068, 

1 regions, avg size 1068.0, avg spacing 1068.0

First_start: 1068, last_end: 1

Reads with neg LLR score, or confirmed or high-qual unaligned seg > 20 bases, or other problem: None.

Gaps in unique-read coverage:  None.

Contig 4.  1 read; 1111 bp (untrimmed), 0 (trimmed).
      1  1111 af050109f1    104 ( 33)  0.00 0.00 0.00 1003 (1111)    0 (1110) 

Contig quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 -1    1111 100.0    1111 100.0  1111.00   (quality -1 = terminal quality 0)

Avg. full length: 1111.0, trimmed (qual > -1): 0.0
Avg. quality: 0.0 per base

Initial, terminal qual 0 segments:  1-1111, (None)

Regions of LLR- adjusted quality < 2.0:
1-1111, 

1 regions, avg size 1111.0, avg spacing 1111.0

First_start: 1111, last_end: 1

Reads with neg LLR score, or confirmed or high-qual unaligned seg > 20 bases, or other problem:

(Lngths init HQ, CF unalgn segs); aligned contig pos [LLR score]; (terminal HQ, CF unalgn); read id; aligned read pos
| confirmed read segments | unaligned read segments matching elsewhere
 (LU = local unaligned, DU = distant unaligned, DA = distant aligned, ** = overlaps trimmed region
 || Best local and distant LLR scores
(0, 0)  1004- 1111 [ 0.0] (0,0)     af050109f1         1004-1111 | 1018 1066 | DA:(1018 1066) || local(+/-) (0.0,0.0), distant (1.0,0.0)

Gaps in unique-read coverage:  None.

Contig 5.  2 reads; 258 bp (untrimmed), 258 (trimmed).
C  -765   307 af070109r1    236 (182)  0.00 0.00 0.00  766 (773)   49 ( 49) 
     -8  1064 af070109f1    224 (178)  0.80 0.00 0.00   16 ( 16)  806 (806) 

Overall discrep rates (%):             0.39 0.00 0.00

Contig quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 90     166  64.3     166  64.3    0.00
 88       3   1.2     169  65.5    0.00
 87       3   1.2     172  66.7    0.00
 86       4   1.6     176  68.2    0.00
 85       1   0.4     177  68.6    0.00
 84       2   0.8     179  69.4    0.00
 83       6   2.3     185  71.7    0.00
 82       1   0.4     186  72.1    0.00
 81       5   1.9     191  74.0    0.00
 80       8   3.1     199  77.1    0.00
 79       7   2.7     206  79.8    0.00
 78       3   1.2     209  81.0    0.00
 77       3   1.2     212  82.2    0.00
 76       3   1.2     215  83.3    0.00
 75       4   1.6     219  84.9    0.00
 74       4   1.6     223  86.4    0.00
 72       1   0.4     224  86.8    0.00
 71      10   3.9     234  90.7    0.00
 69       1   0.4     235  91.1    0.00
 68       1   0.4     236  91.5    0.00
 65       2   0.8     238  92.2    0.00
 56      15   5.8     253  98.1    0.00
 43       5   1.9     258 100.0    0.00   (quality -1 = terminal quality 0)

Avg. full length: 258.0, trimmed (qual > -1): 258.0
Avg. quality: 83.8 per base

Initial, terminal qual 0 segments:  (None), (None)

Regions of LLR- adjusted quality < 2.0:


1 regions, avg size 0.0, avg spacing 258.0

First_start: 8, last_end: 258

Slack, # used pairs (max_score), unused
 0     1  ( 5.5)     0 ( 0.0)        1

LLR histograms (used, unused pairs): 

   DS Gap         Size      Closest read (Start)   Covers   Read length required
                                                    now?        to cover
Top strand: 
 left -     7        7+
  259 - right        0+      af070109f1   (  -8)    No            266+

Bottom strand: 
 left -     0        0+      af070109r1   ( 307)    Yes           307+
  259 - right        0+

Read/contig alignment summary, by read base; trace qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
56    228    228    509 (100.00)     0  0    0   0   0   0     0 (0.00)    0    2 (0.39)
51     31    259    281 ( 55.21)     0  0    0   0   0   0     0 (0.00)    0    2 (0.71)
50     12    271    250 ( 49.12)     0  0    0   0   0   0     0 (0.00)    0    2 (0.80)
47      3    274    238 ( 46.76)     0  0    0   0   0   0     0 (0.00)    0    2 (0.84)
46      7    281    235 ( 46.17)     0  0    0   0   0   0     0 (0.00)    0    2 (0.85)
45      3    284    228 ( 44.79)     0  0    0   0   0   0     0 (0.00)    0    2 (0.88)
44     11    295    225 ( 44.20)     0  0    0   0   0   0     0 (0.00)    0    2 (0.89)
43     22    317    214 ( 42.04)     0  0    0   0   0   0     0 (0.00)    0    2 (0.93)
42     39    356    192 ( 37.72)     0  0    0   0   0   0     0 (0.00)    0    2 (1.04)
41      4    360    153 ( 30.06)     0  0    0   0   0   0     0 (0.00)    0    2 (1.31)
40     33    393    149 ( 29.27)     0  0    0   0   0   0     0 (0.00)    0    2 (1.34)
39      2    395    116 ( 22.79)     0  0    0   0   0   0     0 (0.00)    0    2 (1.72)
38      4    399    114 ( 22.40)     0  0    0   0   0   0     0 (0.00)    0    2 (1.75)
37     38    437    110 ( 21.61)     0  0    0   0   0   0     0 (0.00)    0    2 (1.82)
35      9    446     72 ( 14.15)     0  0    0   0   0   0     0 (0.00)    0    2 (2.78)
34      1    447     63 ( 12.38)     0  0    0   0   0   0     0 (0.00)    0    2 (3.17)
33      4    451     62 ( 12.18)     0  0    0   0   0   0     0 (0.00)    0    2 (3.23)
32      0    451     58 ( 11.39)     0  0    0   0   0   0     0 (0.00)    0    2 (3.45)
31      3    454     58 ( 11.39)     0  0    0   0   0   0     0 (0.00)    0    2 (3.45)
30      1    455     55 ( 10.81)     0  0    0   0   0   0     0 (0.00)    0    2 (3.64)
29     16    471     54 ( 10.61)     0  0    0   0   0   0     0 (0.00)    0    2 (3.70)
28      1    472     38 (  7.47)     0  0    0   0   0   0     0 (0.00)    0    2 (5.26)
27      7    479     37 (  7.27)     0  0    0   0   0   0     0 (0.00)    0    2 (5.41)
26      1    480     30 (  5.89)     0  0    0   0   0   0     0 (0.00)    0    2 (6.67)
25      3    483     29 (  5.70)     0  0    0   0   0   0     0 (0.00)    0    2 (6.90)
24      3    486     26 (  5.11)     0  0    0   0   0   0     0 (0.00)    0    2 (7.69)
23      5    491     23 (  4.52)     0  0    0   0   0   0     0 (0.00)    0    2 (8.70)
22      0    491     18 (  3.54)     0  0    0   0   0   0     0 (0.00)    0    2 (11.11)
21      2    493     18 (  3.54)     0  0    0   0   0   0     0 (0.00)    0    2 (11.11)
20      3    496     16 (  3.14)     0  0    0   0   0   0     0 (0.00)    0    2 (12.50)
19      1    497     13 (  2.55)     0  0    0   0   0   0     0 (0.00)    0    2 (15.38)
18      2    499     12 (  2.36)     0  0    0   0   0   0     0 (0.00)    0    2 (16.67)
16      2    501     10 (  1.96)     0  0    0   0   0   0     0 (0.00)    0    2 (20.00)
15      1    502      8 (  1.57)     0  0    0   0   0   0     0 (0.00)    0    2 (25.00)
14      0    502      7 (  1.38)     0  0    0   0   0   0     0 (0.00)    0    2 (28.57)
13      1    503      7 (  1.38)     0  0    0   0   0   0     0 (0.00)    0    2 (28.57)
11      1    504      6 (  1.18)     0  0    0   0   0   0     0 (0.00)    0    2 (33.33)
10      1    505      5 (  0.98)     0  0    0   0   0   0     0 (0.00)    0    2 (40.00)
 9      1    506      4 (  0.79)     0  0    0   0   0   0     0 (0.00)    0    2 (50.00)
 8      0    506      3 (  0.59)     0  0    0   0   0   0     0 (0.00)    0    2 (66.67)
 7      2    508      3 (  0.59)     0  0    0   2   0   0     2 (100.00)    2    2 (66.67)
 4      1    509      1 (  0.20)     0  0    0   0   0   0     0 (0.00)    2    0 (0.00)
-1      0    509      0 (  0.00)     7  0    0   0   0   0     0 (0.00)    2    0 (0.00)


Read/contig alignment summary, by read base; adjusted qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
90    332    332    509 (100.00)     0  0    0   0   0   0     0 (0.00)    0    2 (0.39)
88      6    338    177 ( 34.77)     0  0    0   0   0   0     0 (0.00)    0    2 (1.13)
87      6    344    171 ( 33.60)     0  0    0   0   0   0     0 (0.00)    0    2 (1.17)
86      8    352    165 ( 32.42)     0  0    0   0   0   0     0 (0.00)    0    2 (1.21)
85      2    354    157 ( 30.84)     0  0    0   0   0   0     0 (0.00)    0    2 (1.27)
84      4    358    155 ( 30.45)     0  0    0   0   0   0     0 (0.00)    0    2 (1.29)
83     12    370    151 ( 29.67)     0  0    0   0   0   0     0 (0.00)    0    2 (1.32)
82      2    372    139 ( 27.31)     0  0    0   0   0   0     0 (0.00)    0    2 (1.44)
81     10    382    137 ( 26.92)     0  0    0   0   0   0     0 (0.00)    0    2 (1.46)
80     16    398    127 ( 24.95)     0  0    0   0   0   0     0 (0.00)    0    2 (1.57)
79     14    412    111 ( 21.81)     0  0    0   0   0   0     0 (0.00)    0    2 (1.80)
78      6    418     97 ( 19.06)     0  0    0   0   0   0     0 (0.00)    0    2 (2.06)
77      6    424     91 ( 17.88)     0  0    0   0   0   0     0 (0.00)    0    2 (2.20)
76      6    430     85 ( 16.70)     0  0    0   0   0   0     0 (0.00)    0    2 (2.35)
75      8    438     79 ( 15.52)     0  0    0   0   0   0     0 (0.00)    0    2 (2.53)
74      8    446     71 ( 13.95)     0  0    0   0   0   0     0 (0.00)    0    2 (2.82)
72      2    448     63 ( 12.38)     0  0    0   0   0   0     0 (0.00)    0    2 (3.17)
71     11    459     61 ( 11.98)     0  0    0   0   0   0     0 (0.00)    0    2 (3.28)
69      2    461     50 (  9.82)     0  0    0   0   0   0     0 (0.00)    0    2 (4.00)
68      2    463     48 (  9.43)     0  0    0   0   0   0     0 (0.00)    0    2 (4.17)
65      2    465     46 (  9.04)     0  0    0   0   0   0     0 (0.00)    0    2 (4.35)
56     15    480     44 (  8.64)     0  0    0   0   0   0     0 (0.00)    0    2 (4.55)
50      2    482     29 (  5.70)     0  0    0   0   0   0     0 (0.00)    0    2 (6.90)
44      6    488     27 (  5.30)     0  0    0   0   0   0     0 (0.00)    0    2 (7.41)
43      5    493     21 (  4.13)     0  0    0   0   0   0     0 (0.00)    0    2 (9.52)
35      1    494     16 (  3.14)     0  0    0   0   0   0     0 (0.00)    0    2 (12.50)
33      1    495     15 (  2.95)     0  0    0   0   0   0     0 (0.00)    0    2 (13.33)
31      1    496     14 (  2.75)     0  0    0   0   0   0     0 (0.00)    0    2 (14.29)
29      3    499     13 (  2.55)     0  0    0   0   0   0     0 (0.00)    0    2 (15.38)
24      1    500     10 (  1.96)     0  0    0   0   0   0     0 (0.00)    0    2 (20.00)
16      1    501      9 (  1.77)     0  0    0   0   0   0     0 (0.00)    0    2 (22.22)
15      1    502      8 (  1.57)     0  0    0   0   0   0     0 (0.00)    0    2 (25.00)
13      1    503      7 (  1.38)     0  0    0   0   0   0     0 (0.00)    0    2 (28.57)
11      1    504      6 (  1.18)     0  0    0   0   0   0     0 (0.00)    0    2 (33.33)
10      1    505      5 (  0.98)     0  0    0   0   0   0     0 (0.00)    0    2 (40.00)
 9      1    506      4 (  0.79)     0  0    0   0   0   0     0 (0.00)    0    2 (50.00)
 7      2    508      3 (  0.59)     0  0    0   2   0   0     2 (100.00)    2    2 (66.67)
 4      1    509      1 (  0.20)     0  0    0   0   0   0     0 (0.00)    2    0 (0.00)
-1      0    509      0 (  0.00)     7  0    0   0   0   0     0 (0.00)    2    0 (0.00)


Depth 0 regions:

Block histogram:
Qual   bases    cum    blocks
 43       5        5        1
 56      15       20        3
 65       2       22        4
 68       1       23        5
 69       1       24        5
 71      10       34        5
 72       1       35        6
 74       4       39        7
 75       4       43        8
 76       3       46        7
 77       3       49        8
 78       3       52        9
 79       7       59       13
 80       8       67       14
 81       5       72       15
 82       1       73       15
 83       6       79       12
 84       2       81       11
 85       1       82       10
 86       4       86        8
 87       3       89        9
 88       3       92        8
 90     166      258        1

SS region: 7 (2.71%), flagged: 0 (0.00%)

Sites with total LLR scores < -3.0  [max pos LLR read, max neg LLR read]  (#discrep top reads, #discrep bottom reads): None.

Read/contig discrepancies (* = higher-quality): None.
0 lower quality discrepant sites.

Reads with neg LLR score, or confirmed or high-qual unaligned seg > 20 bases, or other problem: None.

Gaps in unique-read coverage:   E 8- 258

Contig 6.  2 reads; 108 bp (untrimmed), 108 (trimmed).
C  -912   157 bc110109r1     87 ( 56)  3.70 0.93 0.93  913 (920)   49 ( 49) 
     -8  1056 bc110109f1    100 ( 53)  0.00 0.00 0.00   16 ( 16)  948 (948) 

Overall discrep rates (%):             1.91 0.48 0.48

Contig quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 90      19  17.6      19  17.6    0.00
 89       3   2.8      22  20.4    0.00
 88       5   4.6      27  25.0    0.00
 86       2   1.9      29  26.9    0.00
 85       4   3.7      33  30.6    0.00
 84       1   0.9      34  31.5    0.00
 82       4   3.7      38  35.2    0.00
 81       2   1.9      40  37.0    0.00
 80       6   5.6      46  42.6    0.00
 78       3   2.8      49  45.4    0.00
 77       3   2.8      52  48.1    0.00
 76       2   1.9      54  50.0    0.00
 75       2   1.9      56  51.9    0.00
 74       1   0.9      57  52.8    0.00
 71       2   1.9      59  54.6    0.00
 69       1   0.9      60  55.6    0.00
 61       1   0.9      61  56.5    0.00
 59       1   0.9      62  57.4    0.00
 57       3   2.8      65  60.2    0.00
 55       2   1.9      67  62.0    0.00
 49       3   2.8      70  64.8    0.00
 48       3   2.8      73  67.6    0.00
 47       4   3.7      77  71.3    0.00
 42       5   4.6      82  75.9    0.00
 40       8   7.4      90  83.3    0.00
 37       4   3.7      94  87.0    0.00
 35       1   0.9      95  88.0    0.00
 34       2   1.9      97  89.8    0.00
 33       1   0.9      98  90.7    0.00
 32       1   0.9      99  91.7    0.00
 28       1   0.9     100  92.6    0.01
 24       1   0.9     101  93.5    0.01
 21       2   1.9     103  95.4    0.03
 14       1   0.9     104  96.3    0.07
 10       1   0.9     105  97.2    0.17
  9       1   0.9     106  98.1    0.29
  8       2   1.9     108 100.0    0.61   (quality -1 = terminal quality 0)

Avg. full length: 108.0, trimmed (qual > -1): 108.0
Avg. quality: 63.9 per base

Initial, terminal qual 0 segments:  (None), (None)

Regions of LLR- adjusted quality < 2.0:
70-74, 

2 regions, avg size 2.5, avg spacing 54.0

First_start: 8, last_end: 108

Slack, # used pairs (max_score), unused
 0     1  ( 2.0)     0 ( 0.0)        1

LLR histograms (used, unused pairs): 

   DS Gap         Size      Closest read (Start)   Covers   Read length required
                                                    now?        to cover
Top strand: 
 left -     7        7+
  109 - right        0+      bc110109f1   (  -8)    No            116+

Bottom strand: 
 left -     0        0+      bc110109r1   ( 157)    Yes           157+
  109 - right        0+

Read/contig alignment summary, by read base; trace qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
56     30     30    209 (100.00)     0  0    0   0   0   0     0 (0.00)    0    6 (2.87)
51     11     41    179 ( 85.65)     0  0    0   0   0   0     0 (0.00)    0    6 (3.35)
47      1     42    168 ( 80.38)     0  0    0   0   0   0     0 (0.00)    0    6 (3.57)
46      4     46    167 ( 79.90)     0  0    0   0   0   0     0 (0.00)    0    6 (3.59)
45      5     51    163 ( 77.99)     0  0    0   0   0   0     0 (0.00)    0    6 (3.68)
44      4     55    158 ( 75.60)     0  0    0   0   0   0     0 (0.00)    0    6 (3.80)
43      1     56    154 ( 73.68)     0  0    0   0   0   0     0 (0.00)    0    6 (3.90)
42     16     72    153 ( 73.21)     0  0    0   0   0   0     0 (0.00)    0    6 (3.92)
40     34    106    137 ( 65.55)     0  0    0   0   0   0     0 (0.00)    0    6 (4.38)
38      1    107    103 ( 49.28)     0  0    0   0   0   0     0 (0.00)    0    6 (5.83)
37     13    120    102 ( 48.80)     0  0    0   0   0   0     0 (0.00)    0    6 (5.88)
35      5    125     89 ( 42.58)     0  0    0   0   0   0     0 (0.00)    0    6 (6.74)
34     12    137     84 ( 40.19)     0  0    0   0   0   0     0 (0.00)    0    6 (7.14)
33     10    147     72 ( 34.45)     0  0    0   0   0   0     0 (0.00)    0    6 (8.33)
32      7    154     62 ( 29.67)     0  0    0   0   0   0     0 (0.00)    0    6 (9.68)
30      1    155     55 ( 26.32)     0  0    0   0   0   0     0 (0.00)    0    6 (10.91)
29      4    159     54 ( 25.84)     0  0    0   0   0   0     0 (0.00)    0    6 (11.11)
28      3    162     50 ( 23.92)     0  0    0   0   0   0     0 (0.00)    0    6 (12.00)
27      2    164     47 ( 22.49)     0  0    0   0   0   0     0 (0.00)    0    6 (12.77)
26      4    168     45 ( 21.53)     0  0    0   0   0   1     1 (25.00)    1    6 (13.33)
25      2    170     41 ( 19.62)     0  0    0   0   0   0     0 (0.00)    1    5 (12.20)
24      3    173     39 ( 18.66)     0  0    0   0   0   0     0 (0.00)    1    5 (12.82)
22      2    175     36 ( 17.22)     0  0    0   0   0   0     0 (0.00)    1    5 (13.89)
21      3    178     34 ( 16.27)     0  0    0   0   0   0     0 (0.00)    1    5 (14.71)
20      4    182     31 ( 14.83)     0  0    0   0   0   0     0 (0.00)    1    5 (16.13)
19      4    186     27 ( 12.92)     0  0    0   1   0   0     1 (25.00)    2    5 (18.52)
16      2    188     23 ( 11.00)     0  0    0   0   0   0     0 (0.00)    2    4 (17.39)
15      1    189     21 ( 10.05)     0  0    0   0   0   0     0 (0.00)    2    4 (19.05)
14      1    190     20 (  9.57)     0  0    0   0   0   0     0 (0.00)    2    4 (20.00)
13      1    191     19 (  9.09)     0  0    0   0   0   0     0 (0.00)    2    4 (21.05)
11      2    193     18 (  8.61)     0  0    0   0   0   0     0 (0.00)    2    4 (22.22)
10      2    195     16 (  7.66)     0  0    0   0   0   0     0 (0.00)    2    4 (25.00)
 9      3    198     14 (  6.70)     0  0    0   0   0   0     0 (0.00)    2    4 (28.57)
 8      7    205     11 (  5.26)     0  0    0   1   1   0     2 (28.57)    4    4 (36.36)
 7      4    209      4 (  1.91)     0  0    0   2   0   0     2 (50.00)    6    2 (50.00)
 6      0    209      0 (  0.00)     0  0    0   0   0   0     0 (0.00)    6    0 (0.00)
-1      0    209      0 (  0.00)     7  0    0   0   0   0     0 (0.00)    6    0 (0.00)


Read/contig alignment summary, by read base; adjusted qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
90     38     38    209 (100.00)     0  0    0   0   0   0     0 (0.00)    0    6 (2.87)
89      6     44    171 ( 81.82)     0  0    0   0   0   0     0 (0.00)    0    6 (3.51)
88     10     54    165 ( 78.95)     0  0    0   0   0   0     0 (0.00)    0    6 (3.64)
86      4     58    155 ( 74.16)     0  0    0   0   0   0     0 (0.00)    0    6 (3.87)
85      8     66    151 ( 72.25)     0  0    0   0   0   0     0 (0.00)    0    6 (3.97)
84      2     68    143 ( 68.42)     0  0    0   0   0   0     0 (0.00)    0    6 (4.20)
82      8     76    141 ( 67.46)     0  0    0   0   0   0     0 (0.00)    0    6 (4.26)
81      4     80    133 ( 63.64)     0  0    0   0   0   0     0 (0.00)    0    6 (4.51)
80     12     92    129 ( 61.72)     0  0    0   0   0   0     0 (0.00)    0    6 (4.65)
78      6     98    117 ( 55.98)     0  0    0   0   0   0     0 (0.00)    0    6 (5.13)
77      6    104    111 ( 53.11)     0  0    0   0   0   0     0 (0.00)    0    6 (5.41)
76      4    108    105 ( 50.24)     0  0    0   0   0   0     0 (0.00)    0    6 (5.71)
75      4    112    101 ( 48.33)     0  0    0   0   0   0     0 (0.00)    0    6 (5.94)
74      2    114     97 ( 46.41)     0  0    0   0   0   0     0 (0.00)    0    6 (6.19)
71      2    116     95 ( 45.45)     0  0    0   0   0   0     0 (0.00)    0    6 (6.32)
69      2    118     93 ( 44.50)     0  0    0   0   0   0     0 (0.00)    0    6 (6.45)
61      1    119     91 ( 43.54)     0  0    0   0   0   0     0 (0.00)    0    6 (6.59)
59      1    120     90 ( 43.06)     0  0    0   0   0   0     0 (0.00)    0    6 (6.67)
57      3    123     89 ( 42.58)     0  0    0   0   0   0     0 (0.00)    0    6 (6.74)
55      2    125     86 ( 41.15)     0  0    0   0   0   0     0 (0.00)    0    6 (6.98)
52      1    126     84 ( 40.19)     0  0    0   0   0   0     0 (0.00)    0    6 (7.14)
49      5    131     83 ( 39.71)     0  0    0   0   0   0     0 (0.00)    0    6 (7.23)
48      5    136     78 ( 37.32)     0  0    0   0   0   0     0 (0.00)    0    6 (7.69)
47      5    141     73 ( 34.93)     0  0    0   0   0   0     0 (0.00)    0    6 (8.22)
45      1    142     68 ( 32.54)     0  0    0   0   0   0     0 (0.00)    0    6 (8.82)
44      2    144     67 ( 32.06)     0  0    0   0   0   0     0 (0.00)    0    6 (8.96)
43      2    146     65 ( 31.10)     0  0    0   0   0   0     0 (0.00)    0    6 (9.23)
42      7    153     63 ( 30.14)     0  0    0   0   0   0     0 (0.00)    0    6 (9.52)
41      2    155     56 ( 26.79)     0  0    0   0   0   0     0 (0.00)    0    6 (10.71)
40      8    163     54 ( 25.84)     0  0    0   0   0   0     0 (0.00)    0    6 (11.11)
37      4    167     46 ( 22.01)     0  0    0   0   0   0     0 (0.00)    0    6 (13.04)
35      3    170     42 ( 20.10)     0  0    0   0   0   0     0 (0.00)    0    6 (14.29)
34      2    172     39 ( 18.66)     0  0    0   0   0   0     0 (0.00)    0    6 (15.38)
33      1    173     37 ( 17.70)     0  0    0   0   0   0     0 (0.00)    0    6 (16.22)
32      1    174     36 ( 17.22)     0  0    0   0   0   0     0 (0.00)    0    6 (16.67)
31      1    175     35 ( 16.75)     0  0    0   0   0   0     0 (0.00)    0    6 (17.14)
28      1    176     34 ( 16.27)     0  0    0   0   0   0     0 (0.00)    0    6 (17.65)
26      2    178     33 ( 15.79)     0  0    0   0   0   1     1 (50.00)    1    6 (18.18)
24      1    179     31 ( 14.83)     0  0    0   0   0   0     0 (0.00)    1    5 (16.13)
22      1    180     30 ( 14.35)     0  0    0   0   0   0     0 (0.00)    1    5 (16.67)
21      3    183     29 ( 13.88)     0  0    0   0   0   0     0 (0.00)    1    5 (17.24)
20      2    185     26 ( 12.44)     0  0    0   0   0   0     0 (0.00)    1    5 (19.23)
19      2    187     24 ( 11.48)     0  0    0   1   0   0     1 (50.00)    2    5 (20.83)
16      1    188     22 ( 10.53)     0  0    0   0   0   0     0 (0.00)    2    4 (18.18)
15      1    189     21 ( 10.05)     0  0    0   0   0   0     0 (0.00)    2    4 (19.05)
14      1    190     20 (  9.57)     0  0    0   0   0   0     0 (0.00)    2    4 (20.00)
13      1    191     19 (  9.09)     0  0    0   0   0   0     0 (0.00)    2    4 (21.05)
11      2    193     18 (  8.61)     0  0    0   0   0   0     0 (0.00)    2    4 (22.22)
10      2    195     16 (  7.66)     0  0    0   0   0   0     0 (0.00)    2    4 (25.00)
 9      3    198     14 (  6.70)     0  0    0   0   0   0     0 (0.00)    2    4 (28.57)
 8      7    205     11 (  5.26)     0  0    0   1   1   0     2 (28.57)    4    4 (36.36)
 7      4    209      4 (  1.91)     0  0    0   2   0   0     2 (50.00)    6    2 (50.00)
-1      0    209      0 (  0.00)     7  0    0   0   0   0     0 (0.00)    6    0 (0.00)


Depth 0 regions:

Block histogram:
Qual   bases    cum    blocks
  8       2        2        1
  9       1        3        2
 10       1        4        1
 14       1        5        1
 21       2        7        3
 24       1        8        2
 28       1        9        1
 32       1       10        1
 33       1       11        1
 34       2       13        2
 35       1       14        2
 37       4       18        3
 40       8       26        4
 42       5       31        5
 47       4       35        5
 48       3       38        5
 49       3       41        4
 55       2       43        4
 57       3       46        6
 59       1       47        5
 61       1       48        4
 69       1       49        4
 71       2       51        4
 74       1       52        4
 75       2       54        5
 76       2       56        5
 77       3       59        7
 78       3       62        7
 80       6       68        9
 81       2       70        8
 82       4       74        8
 84       1       75        8
 85       4       79        7
 86       2       81        7
 88       5       86        7
 89       3       89        7
 90      19      108        1

SS region: 7 (6.48%), flagged: 1 (0.93%)

Sites with total LLR scores < -3.0  [max pos LLR read, max neg LLR read]  (#discrep top reads, #discrep bottom reads): None.

Read/contig discrepancies (* = higher-quality): None.
0 lower quality discrepant sites.

Reads with neg LLR score, or confirmed or high-qual unaligned seg > 20 bases, or other problem: None.

Gaps in unique-read coverage:   E 8- 108

Contig 7.  2 reads; 62 bp (untrimmed), 57 (trimmed).
C  -966   109 bf080109r1     57 (  0)  1.61 0.00 0.00  967 (970)   47 ( 52) 
    -10  1063 bf080109f1     48 (  0)  0.00 1.85 0.00   14 ( 14) 1006 (1006) 

Overall discrep rates (%):             0.86 0.86 0.00

Contig quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 80       1   1.6       1   1.6    0.00
 77       3   4.8       4   6.5    0.00
 76       1   1.6       5   8.1    0.00
 75       3   4.8       8  12.9    0.00
 74       2   3.2      10  16.1    0.00
 72       1   1.6      11  17.7    0.00
 71       2   3.2      13  21.0    0.00
 67       1   1.6      14  22.6    0.00
 65       1   1.6      15  24.2    0.00
 64       1   1.6      16  25.8    0.00
 59       3   4.8      19  30.6    0.00
 58       1   1.6      20  32.3    0.00
 57       1   1.6      21  33.9    0.00
 56       1   1.6      22  35.5    0.00
 55       5   8.1      27  43.5    0.00
 52       2   3.2      29  46.8    0.00
 50       2   3.2      31  50.0    0.00
 47       1   1.6      32  51.6    0.00
 45       1   1.6      33  53.2    0.00
 43       1   1.6      34  54.8    0.00
 42       1   1.6      35  56.5    0.00
 40       4   6.5      39  62.9    0.00
 39       1   1.6      40  64.5    0.00
 36       2   3.2      42  67.7    0.00
 35       4   6.5      46  74.2    0.00
 32       5   8.1      51  82.3    0.01
 29       2   3.2      53  85.5    0.01
 27       1   1.6      54  87.1    0.01
 24       1   1.6      55  88.7    0.01
 23       1   1.6      56  90.3    0.02
 20       1   1.6      57  91.9    0.03
 -1       5   8.1      62 100.0    5.03   (quality -1 = terminal quality 0)

Avg. full length: 62.0, trimmed (qual > -1): 57.0
Avg. quality: 46.7 per base

Initial, terminal qual 0 segments:  (None), 58-62

Regions of LLR- adjusted quality < 2.0:
58-62, 

1 regions, avg size 5.0, avg spacing 62.0

First_start: 4, last_end: 57

Slack, # used pairs (max_score), unused
 0     1  ( 1.0)     0 ( 0.0)        1

LLR histograms (used, unused pairs): 

   DS Gap         Size      Closest read (Start)   Covers   Read length required
                                                    now?        to cover
Top strand: 
 left -     3        3+
   58 - right        5+      bf080109f1   ( -10)    No             72+

Bottom strand: 
 left -     0        0+      bf080109r1   ( 109)    Yes           109+
   63 - right        0+

Read/contig alignment summary, by read base; trace qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
56      5      5    112 (100.00)     0  0    0   0   0   0     0 (0.00)    0    2 (1.79)
46      1      6    107 ( 95.54)     0  0    0   0   0   0     0 (0.00)    0    2 (1.87)
44      1      7    106 ( 94.64)     0  0    0   0   0   0     0 (0.00)    0    2 (1.89)
43      0      7    105 ( 93.75)     0  0    0   0   0   0     0 (0.00)    0    2 (1.90)
42      3     10    105 ( 93.75)     0  0    0   0   0   0     0 (0.00)    0    2 (1.90)
40     19     29    102 ( 91.07)     0  0    0   0   0   0     0 (0.00)    0    2 (1.96)
38      0     29     83 ( 74.11)     0  0    0   0   0   0     0 (0.00)    0    2 (2.41)
37      6     35     83 ( 74.11)     0  0    0   0   0   0     0 (0.00)    0    2 (2.41)
36      2     37     77 ( 68.75)     0  0    0   0   0   0     0 (0.00)    0    2 (2.60)
35      6     43     75 ( 66.96)     0  0    0   0   0   0     0 (0.00)    0    2 (2.67)
34      2     45     69 ( 61.61)     0  0    0   0   0   0     0 (0.00)    0    2 (2.90)
33      4     49     67 ( 59.82)     0  0    0   0   0   0     0 (0.00)    0    2 (2.99)
32     10     59     63 ( 56.25)     0  0    0   0   0   0     0 (0.00)    0    2 (3.17)
30      2     61     53 ( 47.32)     0  0    0   0   0   0     0 (0.00)    0    2 (3.77)
29      5     66     51 ( 45.54)     4  0    0   0   0   0     0 (0.00)    0    2 (3.92)
28      1     67     46 ( 41.07)     0  0    0   0   0   0     0 (0.00)    0    2 (4.35)
27      1     68     45 ( 40.18)     0  0    0   0   0   0     0 (0.00)    0    2 (4.44)
25      0     68     44 ( 39.29)     0  0    0   0   0   0     0 (0.00)    0    2 (4.55)
24      2     70     44 ( 39.29)     0  0    0   0   0   0     0 (0.00)    0    2 (4.55)
23      3     73     42 ( 37.50)     0  0    0   0   0   0     0 (0.00)    0    2 (4.76)
22      0     73     39 ( 34.82)     0  0    0   0   0   0     0 (0.00)    0    2 (5.13)
21      2     75     39 ( 34.82)     0  0    0   0   0   0     0 (0.00)    0    2 (5.13)
20      2     77     37 ( 33.04)     0  0    0   0   0   0     0 (0.00)    0    2 (5.41)
19      5     82     35 ( 31.25)     0  0    0   0   0   0     0 (0.00)    0    2 (5.71)
18      2     84     30 ( 26.79)     0  0    0   0   0   0     0 (0.00)    0    2 (6.67)
17      1     85     28 ( 25.00)     0  0    0   0   0   0     0 (0.00)    0    2 (7.14)
16      3     88     27 ( 24.11)     0  0    0   0   0   0     0 (0.00)    0    2 (7.41)
15      2     90     24 ( 21.43)     0  0    0   0   0   0     0 (0.00)    0    2 (8.33)
14      2     92     22 ( 19.64)     0  0    0   0   0   0     0 (0.00)    0    2 (9.09)
13      2     94     20 ( 17.86)     0  0    0   0   0   0     0 (0.00)    0    2 (10.00)
12      3     97     18 ( 16.07)     0  0    0   0   0   0     0 (0.00)    0    2 (11.11)
11      3    100     15 ( 13.39)     0  0    0   0   0   0     0 (0.00)    0    2 (13.33)
10      1    101     12 ( 10.71)     0  0    0   0   0   0     0 (0.00)    0    2 (16.67)
 9      2    103     11 (  9.82)     0  0    0   0   0   0     0 (0.00)    0    2 (18.18)
 8      5    108      9 (  8.04)     0  0    0   1   0   0     1 (20.00)    1    2 (22.22)
 7      1    109      4 (  3.57)     0  0    0   0   0   0     0 (0.00)    1    1 (25.00)
 6      2    111      3 (  2.68)     0  0    0   0   1   0     1 (50.00)    2    1 (33.33)
 4      1    112      1 (  0.89)     0  0    0   0   0   0     0 (0.00)    2    0 (0.00)
-1      5    117      0 (  0.00)     4  0    0   0   0   0     0 (0.00)    2    0 (0.00)


Read/contig alignment summary, by read base; adjusted qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
80      2      2    112 (100.00)     0  0    0   0   0   0     0 (0.00)    0    2 (1.79)
77      6      8    110 ( 98.21)     0  0    0   0   0   0     0 (0.00)    0    2 (1.82)
76      2     10    104 ( 92.86)     0  0    0   0   0   0     0 (0.00)    0    2 (1.92)
75      6     16    102 ( 91.07)     0  0    0   0   0   0     0 (0.00)    0    2 (1.96)
74      4     20     96 ( 85.71)     0  0    0   0   0   0     0 (0.00)    0    2 (2.08)
72      2     22     92 ( 82.14)     0  0    0   0   0   0     0 (0.00)    0    2 (2.17)
71      2     24     90 ( 80.36)     0  0    0   0   0   0     0 (0.00)    0    2 (2.22)
67      2     26     88 ( 78.57)     0  0    0   0   0   0     0 (0.00)    0    2 (2.27)
65      2     28     86 ( 76.79)     0  0    0   0   0   0     0 (0.00)    0    2 (2.33)
64      2     30     84 ( 75.00)     0  0    0   0   0   0     0 (0.00)    0    2 (2.38)
59      6     36     82 ( 73.21)     0  0    0   0   0   0     0 (0.00)    0    2 (2.44)
58      2     38     76 ( 67.86)     0  0    0   0   0   0     0 (0.00)    0    2 (2.63)
57      2     40     74 ( 66.07)     0  0    0   0   0   0     0 (0.00)    0    2 (2.70)
56      2     42     72 ( 64.29)     0  0    0   0   0   0     0 (0.00)    0    2 (2.78)
55      5     47     70 ( 62.50)     0  0    0   0   0   0     0 (0.00)    0    2 (2.86)
54      1     48     65 ( 58.04)     0  0    0   0   0   0     0 (0.00)    0    2 (3.08)
52      3     51     64 ( 57.14)     0  0    0   0   0   0     0 (0.00)    0    2 (3.12)
50      3     54     61 ( 54.46)     0  0    0   0   0   0     0 (0.00)    0    2 (3.28)
48      1     55     58 ( 51.79)     0  0    0   0   0   0     0 (0.00)    0    2 (3.45)
47      4     59     57 ( 50.89)     0  0    0   0   0   0     0 (0.00)    0    2 (3.51)
45      1     60     53 ( 47.32)     0  0    0   0   0   0     0 (0.00)    0    2 (3.77)
44      2     62     52 ( 46.43)     0  0    0   0   0   0     0 (0.00)    0    2 (3.85)
43      1     63     50 ( 44.64)     0  0    0   0   0   0     0 (0.00)    0    2 (4.00)
42      1     64     49 ( 43.75)     0  0    0   0   0   0     0 (0.00)    0    2 (4.08)
40      4     68     48 ( 42.86)     0  0    0   0   0   0     0 (0.00)    0    2 (4.17)
39      1     69     44 ( 39.29)     0  0    0   0   0   0     0 (0.00)    0    2 (4.55)
36      2     71     43 ( 38.39)     0  0    0   0   0   0     0 (0.00)    0    2 (4.65)
35      4     75     41 ( 36.61)     0  0    0   0   0   0     0 (0.00)    0    2 (4.88)
32      5     80     37 ( 33.04)     0  0    0   0   0   0     0 (0.00)    0    2 (5.41)
30      1     81     32 ( 28.57)     0  0    0   0   0   0     0 (0.00)    0    2 (6.25)
29      3     84     31 ( 27.68)     0  0    0   0   0   0     0 (0.00)    0    2 (6.45)
28      1     85     28 ( 25.00)     0  0    0   0   0   0     0 (0.00)    0    2 (7.14)
27      3     88     27 ( 24.11)     0  0    0   0   0   0     0 (0.00)    0    2 (7.41)
26      2     90     24 ( 21.43)     0  0    0   0   0   0     0 (0.00)    0    2 (8.33)
24      1     91     22 ( 19.64)     0  0    0   0   0   0     0 (0.00)    0    2 (9.09)
23      3     94     21 ( 18.75)     0  0    0   0   0   0     0 (0.00)    0    2 (9.52)
20      1     95     18 ( 16.07)     0  0    0   0   0   0     0 (0.00)    0    2 (11.11)
19      1     96     17 ( 15.18)     0  0    0   0   0   0     0 (0.00)    0    2 (11.76)
18      1     97     16 ( 14.29)     0  0    0   0   0   0     0 (0.00)    0    2 (12.50)
16      2     99     15 ( 13.39)     0  0    0   0   0   0     0 (0.00)    0    2 (13.33)
15      1    100     13 ( 11.61)     0  0    0   0   0   0     0 (0.00)    0    2 (15.38)
13      1    101     12 ( 10.71)     0  0    0   0   0   0     0 (0.00)    0    2 (16.67)
11      1    102     11 (  9.82)     0  0    0   0   0   0     0 (0.00)    0    2 (18.18)
 9      2    104     10 (  8.93)     0  0    0   0   0   0     0 (0.00)    0    2 (20.00)
 8      4    108      8 (  7.14)     0  0    0   1   0   0     1 (25.00)    1    2 (25.00)
 7      1    109      4 (  3.57)     0  0    0   0   0   0     0 (0.00)    1    1 (25.00)
 6      2    111      3 (  2.68)     0  0    0   0   1   0     1 (50.00)    2    1 (33.33)
 4      1    112      1 (  0.89)     0  0    0   0   0   0     0 (0.00)    2    0 (0.00)
-1      5    117      0 (  0.00)     8  0    0   0   0   0     0 (0.00)    2    0 (0.00)


Depth 0 regions:

Block histogram:
Qual   bases    cum    blocks
  0       5        5        1
 20       1        6        2
 23       1        7        2
 24       1        8        2
 27       1        9        2
 29       2       11        2
 32       5       16        3
 35       4       20        5
 36       2       22        4
 39       1       23        4
 40       4       27        3
 42       1       28        3
 43       1       29        4
 45       1       30        3
 47       1       31        4
 50       2       33        4
 52       2       35        4
 55       5       40        5
 56       1       41        4
 57       1       42        5
 58       1       43        6
 59       3       46        5
 64       1       47        5
 65       1       48        4
 67       1       49        4
 71       2       51        3
 72       1       52        3
 74       2       54        3
 75       3       57        3
 76       1       58        3
 77       3       61        2
 80       1       62        1

SS region: 8 (12.90%), flagged: 0 (0.00%)

Sites with total LLR scores < -3.0  [max pos LLR read, max neg LLR read]  (#discrep top reads, #discrep bottom reads): None.

Read/contig discrepancies (* = higher-quality): None.
0 lower quality discrepant sites.

Reads with neg LLR score, or confirmed or high-qual unaligned seg > 20 bases, or other problem: None.

Gaps in unique-read coverage:  None.

Contig 8.  2 reads; 396 bp (untrimmed), 396 (trimmed).
C  -590   442 db090109r1    371 (351)  0.00 0.00 0.00  591 (596)   46 ( 46) 
     -6  1014 db090109f1    357 (342)  0.76 0.00 0.25    7 ( 12)  618 (618) 

Overall discrep rates (%):             0.38 0.00 0.13

Contig quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 90     325  82.1     325  82.1    0.00
 89       4   1.0     329  83.1    0.00
 88       6   1.5     335  84.6    0.00
 86       1   0.3     336  84.8    0.00
 85       2   0.5     338  85.4    0.00
 84       1   0.3     339  85.6    0.00
 83       1   0.3     340  85.9    0.00
 82       3   0.8     343  86.6    0.00
 78       1   0.3     344  86.9    0.00
 77       2   0.5     346  87.4    0.00
 75       1   0.3     347  87.6    0.00
 74       1   0.3     348  87.9    0.00
 73       1   0.3     349  88.1    0.00
 71      13   3.3     362  91.4    0.00
 66       5   1.3     367  92.7    0.00
 65       2   0.5     369  93.2    0.00
 61       1   0.3     370  93.4    0.00
 56      10   2.5     380  96.0    0.00
 51      11   2.8     391  98.7    0.00
 46       1   0.3     392  99.0    0.00
 45       4   1.0     396 100.0    0.00   (quality -1 = terminal quality 0)

Avg. full length: 396.0, trimmed (qual > -1): 396.0
Avg. quality: 86.0 per base

Initial, terminal qual 0 segments:  (None), (None)

Regions of LLR- adjusted quality < 2.0:


1 regions, avg size 0.0, avg spacing 396.0

First_start: 6, last_end: 396

Slack, # used pairs (max_score), unused
 0     1  ( 8.5)     0 ( 0.0)        1

LLR histograms (used, unused pairs): 

   DS Gap         Size      Closest read (Start)   Covers   Read length required
                                                    now?        to cover
Top strand: 
 left -     0        0+
  397 - right        0+      db090109f1   (  -6)    No            402+

Bottom strand: 
 left -     0        0+      db090109r1   ( 442)    Yes           442+
  397 - right        0+

Read/contig alignment summary, by read base; trace qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
56    418    418    791 (100.00)     0  0    0   0   0   0     0 (0.00)    0    4 (0.51)
51    172    590    373 ( 47.16)     0  0    0   0   0   0     0 (0.00)    0    4 (1.07)
50     11    601    201 ( 25.41)     0  0    0   0   0   0     0 (0.00)    0    4 (1.99)
48      1    602    190 ( 24.02)     0  0    0   0   0   0     0 (0.00)    0    4 (2.11)
46     12    614    189 ( 23.89)     0  0    0   0   0   0     0 (0.00)    0    4 (2.12)
45     25    639    177 ( 22.38)     0  0    0   0   0   0     0 (0.00)    0    4 (2.26)
44      9    648    152 ( 19.22)     0  0    0   0   0   0     0 (0.00)    0    4 (2.63)
43     13    661    143 ( 18.08)     0  0    0   0   0   0     0 (0.00)    0    4 (2.80)
42      9    670    130 ( 16.43)     0  0    0   0   0   0     0 (0.00)    0    4 (3.08)
40     20    690    121 ( 15.30)     0  0    0   0   0   0     0 (0.00)    0    4 (3.31)
39     12    702    101 ( 12.77)     0  0    0   0   0   0     0 (0.00)    0    4 (3.96)
37      2    704     89 ( 11.25)     0  0    0   0   0   0     0 (0.00)    0    4 (4.49)
35     30    734     87 ( 11.00)     0  0    0   0   0   0     0 (0.00)    0    4 (4.60)
34      7    741     57 (  7.21)     0  0    0   0   0   0     0 (0.00)    0    4 (7.02)
32      6    747     50 (  6.32)     0  0    0   0   0   0     0 (0.00)    0    4 (8.00)
30      1    748     44 (  5.56)     0  0    0   0   0   0     0 (0.00)    0    4 (9.09)
29      5    753     43 (  5.44)     0  0    0   0   0   0     0 (0.00)    0    4 (9.30)
28      1    754     38 (  4.80)     0  0    0   0   0   0     0 (0.00)    0    4 (10.53)
27      2    756     37 (  4.68)     0  0    0   0   0   0     0 (0.00)    0    4 (10.81)
26      3    759     35 (  4.42)     0  0    0   0   0   0     0 (0.00)    0    4 (11.43)
25      1    760     32 (  4.05)     0  0    0   0   0   0     0 (0.00)    0    4 (12.50)
24      3    763     31 (  3.92)     0  0    0   0   0   0     0 (0.00)    0    4 (12.90)
23      1    764     28 (  3.54)     0  0    0   0   0   0     0 (0.00)    0    4 (14.29)
21      4    768     27 (  3.41)     0  0    0   0   0   0     0 (0.00)    0    4 (14.81)
20      0    768     23 (  2.91)     0  0    0   0   0   0     0 (0.00)    0    4 (17.39)
19      3    771     23 (  2.91)     0  0    0   0   0   0     0 (0.00)    0    4 (17.39)
18      1    772     20 (  2.53)     0  0    0   0   0   0     0 (0.00)    0    4 (20.00)
17      0    772     19 (  2.40)     0  0    0   0   0   0     0 (0.00)    0    4 (21.05)
15      0    772     19 (  2.40)     0  0    0   0   0   0     0 (0.00)    0    4 (21.05)
14      1    773     19 (  2.40)     0  0    0   0   0   0     0 (0.00)    0    4 (21.05)
13      3    776     18 (  2.28)     0  0    0   0   0   1     1 (33.33)    1    4 (22.22)
12      1    777     15 (  1.90)     0  0    0   0   0   0     0 (0.00)    1    3 (20.00)
11      1    778     14 (  1.77)     0  0    0   0   0   0     0 (0.00)    1    3 (21.43)
10      6    784     13 (  1.64)     0  0    0   2   0   0     2 (33.33)    3    3 (23.08)
 9      4    788      7 (  0.88)     0  0    0   1   0   0     1 (25.00)    4    1 (14.29)
 8      2    790      3 (  0.38)     0  0    0   0   0   0     0 (0.00)    4    0 (0.00)
 7      1    791      1 (  0.13)     0  0    0   0   0   0     0 (0.00)    4    0 (0.00)
-1      0    791      0 (  0.00)     0  0    0   0   0   0     0 (0.00)    4    0 (0.00)


Read/contig alignment summary, by read base; adjusted qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
90    650    650    786 (100.00)     0  0    0   0   0   0     0 (0.00)    0    3 (0.38)
89      8    658    136 ( 17.30)     0  0    0   0   0   0     0 (0.00)    0    3 (2.21)
88     12    670    128 ( 16.28)     0  0    0   0   0   0     0 (0.00)    0    3 (2.34)
86      2    672    116 ( 14.76)     0  0    0   0   0   0     0 (0.00)    0    3 (2.59)
85      4    676    114 ( 14.50)     0  0    0   0   0   0     0 (0.00)    0    3 (2.63)
84      2    678    110 ( 13.99)     0  0    0   0   0   0     0 (0.00)    0    3 (2.73)
83      2    680    108 ( 13.74)     0  0    0   0   0   0     0 (0.00)    0    3 (2.78)
82      6    686    106 ( 13.49)     0  0    0   0   0   0     0 (0.00)    0    3 (2.83)
78      2    688    100 ( 12.72)     0  0    0   0   0   0     0 (0.00)    0    3 (3.00)
77      4    692     98 ( 12.47)     0  0    0   0   0   0     0 (0.00)    0    3 (3.06)
75      2    694     94 ( 11.96)     0  0    0   0   0   0     0 (0.00)    0    3 (3.19)
74      2    696     92 ( 11.70)     0  0    0   0   0   0     0 (0.00)    0    3 (3.26)
73      2    698     90 ( 11.45)     0  0    0   0   0   0     0 (0.00)    0    3 (3.33)
71     13    711     88 ( 11.20)     0  0    0   0   0   0     0 (0.00)    0    3 (3.41)
66     10    721     75 (  9.54)     0  0    0   0   0   0     0 (0.00)    0    3 (4.00)
65      2    723     65 (  8.27)     0  0    0   0   0   0     0 (0.00)    0    3 (4.62)
61      3    726     63 (  8.02)     0  0    0   0   0   0     0 (0.00)    0    3 (4.76)
59      1    727     60 (  7.63)     0  0    0   0   0   0     0 (0.00)    0    3 (5.00)
57      1    728     59 (  7.51)     0  0    0   0   0   0     0 (0.00)    0    3 (5.08)
56     10    738     58 (  7.38)     0  0    0   0   0   0     0 (0.00)    0    3 (5.17)
55      1    739     48 (  6.11)     0  0    0   0   0   0     0 (0.00)    0    3 (6.25)
51     11    750     47 (  5.98)     0  0    0   0   0   0     0 (0.00)    0    3 (6.38)
46      2    752     36 (  4.58)     0  0    0   0   0   0     0 (0.00)    0    3 (8.33)
45      4    756     34 (  4.33)     0  0    0   0   0   0     0 (0.00)    0    3 (8.82)
44      4    760     30 (  3.82)     0  0    0   0   0   0     0 (0.00)    0    3 (10.00)
40      3    763     26 (  3.31)     0  0    0   0   0   0     0 (0.00)    0    3 (11.54)
39      1    764     23 (  2.93)     0  0    0   0   0   0     0 (0.00)    0    3 (13.04)
36      1    765     22 (  2.80)     0  0    0   0   0   0     0 (0.00)    0    3 (13.64)
34      2    767     21 (  2.67)     0  0    0   0   0   0     0 (0.00)    0    3 (14.29)
29      1    768     19 (  2.42)     0  0    0   0   0   0     0 (0.00)    0    3 (15.79)
28      1    769     18 (  2.29)     0  0    0   0   0   0     0 (0.00)    0    3 (16.67)
27      1    770     17 (  2.16)     0  0    0   0   0   0     0 (0.00)    0    3 (17.65)
26      1    771     16 (  2.04)     0  0    0   0   0   0     0 (0.00)    0    3 (18.75)
24      2    773     15 (  1.91)     0  0    0   0   0   0     0 (0.00)    0    3 (20.00)
23      1    774     13 (  1.65)     0  0    0   0   0   0     0 (0.00)    0    3 (23.08)
21      1    775     12 (  1.53)     0  0    0   0   0   0     0 (0.00)    0    3 (25.00)
13      2    777     11 (  1.40)     0  0    0   0   0   1     1 (50.00)    1    3 (27.27)
12      1    778      9 (  1.15)     0  0    0   0   0   0     0 (0.00)    1    2 (22.22)
10      6    784      8 (  1.02)     0  0    0   2   0   0     2 (33.33)    3    2 (25.00)
 9      2    786      2 (  0.25)     0  0    0   0   0   0     0 (0.00)    3    0 (0.00)
-1      5    791      0 (  0.00)     0  0    0   1   0   0     1 (20.00)    4    0 (0.00)


Depth 0 regions:

Block histogram:
Qual   bases    cum    blocks
 45       4        4        1
 46       1        5        2
 51      11       16        3
 56      10       26        4
 61       1       27        5
 65       2       29        5
 66       5       34        4
 71      13       47        4
 73       1       48        4
 74       1       49        5
 75       1       50        4
 77       2       52        3
 78       1       53        3
 82       3       56        4
 83       1       57        4
 84       1       58        5
 85       2       60        5
 86       1       61        5
 88       6       67        6
 89       4       71        7
 90     325      396        1

SS region: 0 (0.00%), flagged: 0 (0.00%)

Sites with total LLR scores < -3.0  [max pos LLR read, max neg LLR read]  (#discrep top reads, #discrep bottom reads):
  396     -4.0  [-4.0,  0.0]  (0, 1)

Read/contig discrepancies (* = higher-quality): None.
0 lower quality discrepant sites.

Reads with neg LLR score, or confirmed or high-qual unaligned seg > 20 bases, or other problem: None.

Gaps in unique-read coverage:   E 6- 396

Contig 9.  2 reads; 63 bp (untrimmed), 61 (trimmed).
C  -963   109 dc060109r1     60 (  0)  0.00 0.00 0.00  964 (967)   49 ( 49) 
     -7  1055 dc060109f1     44 (  0)  0.00 0.00 5.00   11 ( 11)  992 (995) 

Overall discrep rates (%):             0.00 0.00 2.50

Contig quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 90       3   4.8       3   4.8    0.00
 87       1   1.6       4   6.3    0.00
 85       3   4.8       7  11.1    0.00
 81       6   9.5      13  20.6    0.00
 75       1   1.6      14  22.2    0.00
 73       1   1.6      15  23.8    0.00
 71       4   6.3      19  30.2    0.00
 69       1   1.6      20  31.7    0.00
 68       1   1.6      21  33.3    0.00
 66       1   1.6      22  34.9    0.00
 64       1   1.6      23  36.5    0.00
 63       1   1.6      24  38.1    0.00
 61       1   1.6      25  39.7    0.00
 57       1   1.6      26  41.3    0.00
 56       7  11.1      33  52.4    0.00
 55       2   3.2      35  55.6    0.00
 51       2   3.2      37  58.7    0.00
 45       6   9.5      43  68.3    0.00
 44       2   3.2      45  71.4    0.00
 42       1   1.6      46  73.0    0.00
 39       4   6.3      50  79.4    0.00
 35       8  12.7      58  92.1    0.00
 33       1   1.6      59  93.7    0.00
 19       1   1.6      60  95.2    0.02
 15       1   1.6      61  96.8    0.05
 -1       2   3.2      63 100.0    2.05   (quality -1 = terminal quality 0)

Avg. full length: 63.0, trimmed (qual > -1): 61.0
Avg. quality: 55.3 per base

Initial, terminal qual 0 segments:  (None), 62-63

Regions of LLR- adjusted quality < 2.0:
60-63, 

1 regions, avg size 4.0, avg spacing 63.0

First_start: 4, last_end: 60

Slack, # used pairs (max_score), unused
 0     0  ( 0.0)     0 ( 0.0)        1
 1     1  ( 0.5)     0 ( 0.0)        0

LLR histograms (used, unused pairs): 

   DS Gap         Size      Closest read (Start)   Covers   Read length required
                                                    now?        to cover
Top strand: 
 left -     3        3+
   64 - right        0+      dc060109f1   (  -7)    No             70+

Bottom strand: 
 left -     0        0+      dc060109r1   ( 109)    Yes           109+
   61 - right        3+

Read/contig alignment summary, by read base; trace qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
56     14     14    117 (100.00)     0  0    0   0   0   0     0 (0.00)    0    3 (2.56)
51      2     16    103 ( 88.03)     0  0    0   0   0   0     0 (0.00)    0    3 (2.91)
47      2     18    101 ( 86.32)     0  0    0   0   0   0     0 (0.00)    0    3 (2.97)
46      6     24     99 ( 84.62)     0  0    0   0   0   0     0 (0.00)    0    3 (3.03)
45      6     30     93 ( 79.49)     0  0    0   0   0   0     0 (0.00)    0    3 (3.23)
44      3     33     87 ( 74.36)     0  0    0   0   0   0     0 (0.00)    0    3 (3.45)
43      1     34     84 ( 71.79)     0  0    0   0   0   0     0 (0.00)    0    3 (3.57)
42      5     39     83 ( 70.94)     0  0    0   0   0   0     0 (0.00)    0    3 (3.61)
40      5     44     78 ( 66.67)     0  0    0   0   0   0     0 (0.00)    0    3 (3.85)
39     12     56     73 ( 62.39)     0  0    0   0   0   0     0 (0.00)    0    3 (4.11)
35     13     69     61 ( 52.14)     0  0    0   0   0   0     0 (0.00)    0    3 (4.92)
34      4     73     48 ( 41.03)     0  0    0   0   0   0     0 (0.00)    0    3 (6.25)
33      1     74     44 ( 37.61)     0  0    0   0   0   0     0 (0.00)    0    3 (6.82)
31      3     77     43 ( 36.75)     0  0    0   0   0   0     0 (0.00)    0    3 (6.98)
29      2     79     40 ( 34.19)     0  0    0   0   0   0     0 (0.00)    0    3 (7.50)
21      2     81     38 ( 32.48)     0  0    0   0   0   0     0 (0.00)    0    3 (7.89)
20      1     82     36 ( 30.77)     0  0    0   0   0   0     0 (0.00)    0    3 (8.33)
19      7     89     35 ( 29.91)     0  0    0   0   0   0     0 (0.00)    0    3 (8.57)
17      2     91     28 ( 23.93)     0  0    0   0   0   0     0 (0.00)    0    3 (10.71)
16      2     93     26 ( 22.22)     0  0    0   0   0   0     0 (0.00)    0    3 (11.54)
15      2     95     24 ( 20.51)     0  0    0   0   0   0     0 (0.00)    0    3 (12.50)
13      4     99     22 ( 18.80)     0  0    0   0   0   0     0 (0.00)    0    3 (13.64)
12      3    102     18 ( 15.38)     0  0    0   0   0   0     0 (0.00)    0    3 (16.67)
11      1    103     15 ( 12.82)     0  0    0   0   0   0     0 (0.00)    0    3 (20.00)
10      2    105     14 ( 11.97)     0  0    0   0   0   1     1 (50.00)    1    3 (21.43)
 9      4    109     12 ( 10.26)     0  0    0   0   0   1     1 (25.00)    2    2 (16.67)
 8      1    110      8 (  6.84)     0  0    0   0   0   0     0 (0.00)    2    1 (12.50)
 7      4    114      7 (  5.98)     0  0    0   0   0   1     1 (25.00)    3    1 (14.29)
 4      3    117      3 (  2.56)     0  0    0   0   0   0     0 (0.00)    3    0 (0.00)
-1      0    117      0 (  0.00)     6  0    0   0   0   0     0 (0.00)    3    0 (0.00)


Read/contig alignment summary, by read base; adjusted qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
90      6      6    115 (100.00)     0  0    0   0   0   0     0 (0.00)    0    3 (2.61)
87      2      8    109 ( 94.78)     0  0    0   0   0   0     0 (0.00)    0    3 (2.75)
85      6     14    107 ( 93.04)     0  0    0   0   0   0     0 (0.00)    0    3 (2.80)
81     12     26    101 ( 87.83)     0  0    0   0   0   0     0 (0.00)    0    3 (2.97)
75      2     28     89 ( 77.39)     0  0    0   0   0   0     0 (0.00)    0    3 (3.37)
73      2     30     87 ( 75.65)     0  0    0   0   0   0     0 (0.00)    0    3 (3.45)
71      6     36     85 ( 73.91)     0  0    0   0   0   0     0 (0.00)    0    3 (3.53)
69      1     37     79 ( 68.70)     0  0    0   0   0   0     0 (0.00)    0    3 (3.80)
68      1     38     78 ( 67.83)     0  0    0   0   0   0     0 (0.00)    0    3 (3.85)
66      1     39     77 ( 66.96)     0  0    0   0   0   0     0 (0.00)    0    3 (3.90)
64      1     40     76 ( 66.09)     0  0    0   0   0   0     0 (0.00)    0    3 (3.95)
63      2     42     75 ( 65.22)     0  0    0   0   0   0     0 (0.00)    0    3 (4.00)
61      1     43     73 ( 63.48)     0  0    0   0   0   0     0 (0.00)    0    3 (4.11)
57      1     44     72 ( 62.61)     0  0    0   0   0   0     0 (0.00)    0    3 (4.17)
56      8     52     71 ( 61.74)     0  0    0   0   0   0     0 (0.00)    0    3 (4.23)
55      2     54     63 ( 54.78)     0  0    0   0   0   0     0 (0.00)    0    3 (4.76)
51      2     56     61 ( 53.04)     0  0    0   0   0   0     0 (0.00)    0    3 (4.92)
49      1     57     59 ( 51.30)     0  0    0   0   0   0     0 (0.00)    0    3 (5.08)
47      2     59     58 ( 50.43)     0  0    0   0   0   0     0 (0.00)    0    3 (5.17)
45      6     65     56 ( 48.70)     0  0    0   0   0   0     0 (0.00)    0    3 (5.36)
44      4     69     50 ( 43.48)     0  0    0   0   0   0     0 (0.00)    0    3 (6.00)
43      1     70     46 ( 40.00)     0  0    0   0   0   0     0 (0.00)    0    3 (6.52)
42      2     72     45 ( 39.13)     0  0    0   0   0   0     0 (0.00)    0    3 (6.67)
39      4     76     43 ( 37.39)     0  0    0   0   0   0     0 (0.00)    0    3 (6.98)
35      9     85     39 ( 33.91)     0  0    0   0   0   0     0 (0.00)    0    3 (7.69)
34      3     88     30 ( 26.09)     0  0    0   0   0   0     0 (0.00)    0    3 (10.00)
33      1     89     27 ( 23.48)     0  0    0   0   0   0     0 (0.00)    0    3 (11.11)
32      1     90     26 ( 22.61)     0  0    0   0   0   0     0 (0.00)    0    3 (11.54)
31      1     91     25 ( 21.74)     0  0    0   0   0   0     0 (0.00)    0    3 (12.00)
28      2     93     24 ( 20.87)     0  0    0   0   0   0     0 (0.00)    0    3 (12.50)
27      3     96     22 ( 19.13)     0  0    0   0   0   0     0 (0.00)    0    3 (13.64)
22      1     97     19 ( 16.52)     0  0    0   0   0   0     0 (0.00)    0    3 (15.79)
19      3    100     18 ( 15.65)     0  0    0   0   0   0     0 (0.00)    0    3 (16.67)
16      1    101     15 ( 13.04)     0  0    0   0   0   0     0 (0.00)    0    3 (20.00)
15      1    102     14 ( 12.17)     0  0    0   0   0   0     0 (0.00)    0    3 (21.43)
13      1    103     13 ( 11.30)     0  0    0   0   0   0     0 (0.00)    0    3 (23.08)
11      1    104     12 ( 10.43)     0  0    0   0   0   0     0 (0.00)    0    3 (25.00)
10      2    106     11 (  9.57)     0  0    0   0   0   1     1 (50.00)    1    3 (27.27)
 9      4    110      9 (  7.83)     0  0    0   0   0   1     1 (25.00)    2    2 (22.22)
 8      1    111      5 (  4.35)     0  0    0   0   0   0     0 (0.00)    2    1 (20.00)
 7      3    114      4 (  3.48)     0  0    0   0   0   1     1 (33.33)    3    1 (25.00)
 4      1    115      1 (  0.87)     0  0    0   0   0   0     0 (0.00)    3    0 (0.00)
-1      2    117      0 (  0.00)     6  0    0   0   0   0     0 (0.00)    3    0 (0.00)


Depth 0 regions:

Block histogram:
Qual   bases    cum    blocks
  0       2        2        1
 15       1        3        1
 19       1        4        1
 33       1        5        1
 35       8       13        3
 39       4       17        3
 42       1       18        3
 44       2       20        4
 45       6       26        4
 51       2       28        4
 55       2       30        4
 56       7       37        3
 57       1       38        3
 61       1       39        3
 63       1       40        3
 64       1       41        4
 66       1       42        4
 68       1       43        3
 69       1       44        2
 71       4       48        3
 73       1       49        2
 75       1       50        2
 81       6       56        3
 85       3       59        2
 87       1       60        2
 90       3       63        1

SS region: 6 (9.52%), flagged: 0 (0.00%)

Sites with total LLR scores < -3.0  [max pos LLR read, max neg LLR read]  (#discrep top reads, #discrep bottom reads): None.

Read/contig discrepancies (* = higher-quality): None.
0 lower quality discrepant sites.

Reads with neg LLR score, or confirmed or high-qual unaligned seg > 20 bases, or other problem: None.

Gaps in unique-read coverage:  None.

Contig 10.  2 reads; 49 bp (untrimmed), 49 (trimmed).
C  -924    95 ca110109r1     49 ( 33)  0.00 0.00 0.00  925 (932)   46 ( 46) 
     -8  1008 ca110109f1     42 ( 33)  0.00 0.00 0.00   16 ( 16)  959 (959) 

Overall discrep rates (%):             0.00 0.00 0.00

Contig quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 90       3   6.1       3   6.1    0.00
 85       1   2.0       4   8.2    0.00
 81       1   2.0       5  10.2    0.00
 80       1   2.0       6  12.2    0.00
 78       1   2.0       7  14.3    0.00
 77       1   2.0       8  16.3    0.00
 76       2   4.1      10  20.4    0.00
 75       1   2.0      11  22.4    0.00
 74       1   2.0      12  24.5    0.00
 73       1   2.0      13  26.5    0.00
 72       4   8.2      17  34.7    0.00
 71       1   2.0      18  36.7    0.00
 69       3   6.1      21  42.9    0.00
 68       2   4.1      23  46.9    0.00
 67       1   2.0      24  49.0    0.00
 65       2   4.1      26  53.1    0.00
 63       1   2.0      27  55.1    0.00
 61       2   4.1      29  59.2    0.00
 57       1   2.0      30  61.2    0.00
 55       3   6.1      33  67.3    0.00
 52       2   4.1      35  71.4    0.00
 51       3   6.1      38  77.6    0.00
 46       1   2.0      39  79.6    0.00
 45       1   2.0      40  81.6    0.00
 35       3   6.1      43  87.8    0.00
 29       3   6.1      46  93.9    0.00
 24       1   2.0      47  95.9    0.01
 23       2   4.1      49 100.0    0.02   (quality -1 = terminal quality 0)

Avg. full length: 49.0, trimmed (qual > -1): 49.0
Avg. quality: 60.4 per base

Initial, terminal qual 0 segments:  (None), (None)

Regions of LLR- adjusted quality < 2.0:


1 regions, avg size 0.0, avg spacing 49.0

First_start: 8, last_end: 49

Slack, # used pairs (max_score), unused
 0     1  ( 0.9)     0 ( 0.0)        1

LLR histograms (used, unused pairs): 

   DS Gap         Size      Closest read (Start)   Covers   Read length required
                                                    now?        to cover
Top strand: 
 left -     7        7+
   50 - right        0+      ca110109f1   (  -8)    No             57+

Bottom strand: 
 left -     0        0+      ca110109r1   (  95)    Yes            95+
   50 - right        0+

Read/contig alignment summary, by read base; trace qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
56      8      8     91 (100.00)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
51     13     21     83 ( 91.21)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
48      1     22     70 ( 76.92)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
46      7     29     69 ( 75.82)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
45      1     30     62 ( 68.13)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
44      1     31     61 ( 67.03)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
43      1     32     60 ( 65.93)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
42      3     35     59 ( 64.84)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
40     10     45     56 ( 61.54)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
37      7     52     46 ( 50.55)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
35      5     57     39 ( 42.86)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
32      3     60     34 ( 37.36)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
30      1     61     31 ( 34.07)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
29      3     64     30 ( 32.97)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
25      3     67     27 ( 29.67)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
24      1     68     24 ( 26.37)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
23      3     71     23 ( 25.27)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
22      2     73     20 ( 21.98)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
21      2     75     18 ( 19.78)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
19      2     77     16 ( 17.58)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
18      3     80     14 ( 15.38)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
17      4     84     11 ( 12.09)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
16      2     86      7 (  7.69)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
15      1     87      5 (  5.49)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
14      0     87      4 (  4.40)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
13      1     88      4 (  4.40)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
10      1     89      3 (  3.30)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
 9      0     89      2 (  2.20)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
 8      2     91      2 (  2.20)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
-1      0     91      0 (  0.00)     7  0    0   0   0   0     0 (0.00)    0    0 (0.00)


Read/contig alignment summary, by read base; adjusted qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
90      6      6     91 (100.00)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
85      2      8     85 ( 93.41)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
81      2     10     83 ( 91.21)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
80      2     12     81 ( 89.01)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
78      2     14     79 ( 86.81)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
77      2     16     77 ( 84.62)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
76      4     20     75 ( 82.42)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
75      2     22     71 ( 78.02)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
74      2     24     69 ( 75.82)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
73      2     26     67 ( 73.63)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
72      8     34     65 ( 71.43)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
71      2     36     57 ( 62.64)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
69      6     42     55 ( 60.44)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
68      4     46     49 ( 53.85)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
67      2     48     45 ( 49.45)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
65      4     52     43 ( 47.25)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
63      1     53     39 ( 42.86)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
61      2     55     38 ( 41.76)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
57      1     56     36 ( 39.56)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
55      5     61     35 ( 38.46)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
54      2     63     30 ( 32.97)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
52      5     68     28 ( 30.77)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
51      3     71     23 ( 25.27)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
50      1     72     20 ( 21.98)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
46      2     74     19 ( 20.88)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
45      1     75     17 ( 18.68)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
42      2     77     16 ( 17.58)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
40      1     78     14 ( 15.38)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
35      3     81     13 ( 14.29)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
32      2     83     10 ( 10.99)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
29      3     86      8 (  8.79)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
24      1     87      5 (  5.49)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
23      2     89      4 (  4.40)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
16      1     90      2 (  2.20)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
10      1     91      1 (  1.10)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
-1      0     91      0 (  0.00)     7  0    0   0   0   0     0 (0.00)    0    0 (0.00)


Depth 0 regions:

Block histogram:
Qual   bases    cum    blocks
 23       2        2        1
 24       1        3        1
 29       3        6        2
 35       3        9        1
 45       1       10        1
 46       1       11        2
 51       3       14        2
 52       2       16        3
 55       3       19        2
 57       1       20        3
 61       2       22        3
 63       1       23        3
 65       2       25        4
 67       1       26        4
 68       2       28        4
 69       3       31        4
 71       1       32        5
 72       4       36        6
 73       1       37        6
 74       1       38        6
 75       1       39        5
 76       2       41        4
 77       1       42        3
 78       1       43        3
 80       1       44        3
 81       1       45        2
 85       1       46        2
 90       3       49        1

SS region: 7 (14.29%), flagged: 0 (0.00%)

Sites with total LLR scores < -3.0  [max pos LLR read, max neg LLR read]  (#discrep top reads, #discrep bottom reads):
   49     -4.0  [-4.0,  0.0]  (0, 1)

Read/contig discrepancies (* = higher-quality): None.
0 lower quality discrepant sites.

Reads with neg LLR score, or confirmed or high-qual unaligned seg > 20 bases, or other problem: None.

Gaps in unique-read coverage:   E 8- 49

Contig 11.  2 reads; 212 bp (untrimmed), 212 (trimmed).
C  -799   257 cb040109r1    205 (156)  0.00 0.00 0.00  800 (802)   45 ( 45) 
     -8  1047 cb040109f1    196 (155)  0.48 0.48 0.00   11 ( 11)  835 (835) 

Overall discrep rates (%):             0.24 0.24 0.00

Contig quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 90     142  67.0     142  67.0    0.00
 88       1   0.5     143  67.5    0.00
 87       1   0.5     144  67.9    0.00
 85      13   6.1     157  74.1    0.00
 84       1   0.5     158  74.5    0.00
 83       3   1.4     161  75.9    0.00
 82       5   2.4     166  78.3    0.00
 81       2   0.9     168  79.2    0.00
 80       2   0.9     170  80.2    0.00
 79       2   0.9     172  81.1    0.00
 73       1   0.5     173  81.6    0.00
 71       7   3.3     180  84.9    0.00
 68       2   0.9     182  85.8    0.00
 66       3   1.4     185  87.3    0.00
 63       2   0.9     187  88.2    0.00
 62       1   0.5     188  88.7    0.00
 60       1   0.5     189  89.2    0.00
 58       2   0.9     191  90.1    0.00
 56       7   3.3     198  93.4    0.00
 55       1   0.5     199  93.9    0.00
 51       7   3.3     206  97.2    0.00
 45       1   0.5     207  97.6    0.00
 33       1   0.5     208  98.1    0.00
 24       2   0.9     210  99.1    0.01
 18       2   0.9     212 100.0    0.04   (quality -1 = terminal quality 0)

Avg. full length: 212.0, trimmed (qual > -1): 212.0
Avg. quality: 82.6 per base

Initial, terminal qual 0 segments:  (None), (None)

Regions of LLR- adjusted quality < 2.0:
23-24, 

2 regions, avg size 1.0, avg spacing 106.0

First_start: 3, last_end: 212

Slack, # used pairs (max_score), unused
 0     1  ( 4.4)     0 ( 0.0)        1

LLR histograms (used, unused pairs): 

   DS Gap         Size      Closest read (Start)   Covers   Read length required
                                                    now?        to cover
Top strand: 
 left -     2        2+
  213 - right        0+      cb040109f1   (  -8)    No            220+

Bottom strand: 
 left -     0        0+      cb040109r1   ( 257)    Yes           257+
  213 - right        0+

Read/contig alignment summary, by read base; trace qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
56    149    149    423 (100.00)     0  0    0   0   0   0     0 (0.00)    0    2 (0.47)
51     84    233    274 ( 64.78)     0  0    0   0   0   0     0 (0.00)    0    2 (0.73)
48      3    236    190 ( 44.92)     0  0    0   0   0   0     0 (0.00)    0    2 (1.05)
46      8    244    187 ( 44.21)     0  0    0   0   0   0     0 (0.00)    0    2 (1.07)
45     43    287    179 ( 42.32)     0  0    0   0   0   0     0 (0.00)    0    2 (1.12)
44      3    290    136 ( 32.15)     0  0    0   0   0   0     0 (0.00)    0    2 (1.47)
43      8    298    133 ( 31.44)     0  0    0   0   0   0     0 (0.00)    0    2 (1.50)
42      1    299    125 ( 29.55)     0  0    0   0   0   0     0 (0.00)    0    2 (1.60)
40     46    345    124 ( 29.31)     0  0    0   0   0   0     0 (0.00)    0    2 (1.61)
39      2    347     78 ( 18.44)     0  0    0   0   0   0     0 (0.00)    0    2 (2.56)
37      5    352     76 ( 17.97)     0  0    0   0   0   0     0 (0.00)    0    2 (2.63)
36      1    353     71 ( 16.78)     0  0    0   0   0   0     0 (0.00)    0    2 (2.82)
35      5    358     70 ( 16.55)     0  0    0   0   0   0     0 (0.00)    0    2 (2.86)
34     16    374     65 ( 15.37)     0  0    0   0   0   0     0 (0.00)    0    2 (3.08)
33      1    375     49 ( 11.58)     0  0    0   0   0   0     0 (0.00)    0    2 (4.08)
32      1    376     48 ( 11.35)     0  0    0   0   0   0     0 (0.00)    0    2 (4.17)
31      1    377     47 ( 11.11)     0  0    0   0   0   0     0 (0.00)    0    2 (4.26)
29      4    381     46 ( 10.87)     0  0    0   0   0   0     0 (0.00)    0    2 (4.35)
28      2    383     42 (  9.93)     0  0    0   0   0   0     0 (0.00)    0    2 (4.76)
27      2    385     40 (  9.46)     0  0    0   0   0   0     0 (0.00)    0    2 (5.00)
26      2    387     38 (  8.98)     0  0    0   0   0   0     0 (0.00)    0    2 (5.26)
25      6    393     36 (  8.51)     0  0    0   0   0   0     0 (0.00)    0    2 (5.56)
24      3    396     30 (  7.09)     0  0    0   0   0   0     0 (0.00)    0    2 (6.67)
19      3    399     27 (  6.38)     0  0    0   0   0   0     0 (0.00)    0    2 (7.41)
18      3    402     24 (  5.67)     0  0    0   0   0   0     0 (0.00)    0    2 (8.33)
17      1    403     21 (  4.96)     0  0    0   0   0   0     0 (0.00)    0    2 (9.52)
15      3    406     20 (  4.73)     0  0    0   0   0   0     0 (0.00)    0    2 (10.00)
14      0    406     17 (  4.02)     0  0    0   0   0   0     0 (0.00)    0    2 (11.76)
13      3    409     17 (  4.02)     0  0    0   0   0   0     0 (0.00)    0    2 (11.76)
12      1    410     14 (  3.31)     0  0    0   1   0   0     1 (100.00)    1    2 (14.29)
11      1    411     13 (  3.07)     0  0    0   0   0   0     0 (0.00)    1    1 (7.69)
10      0    411     12 (  2.84)     0  0    0   0   0   0     0 (0.00)    1    1 (8.33)
 9      5    416     12 (  2.84)     0  0    0   0   0   0     0 (0.00)    1    1 (8.33)
 8      1    417      7 (  1.65)     0  0    0   0   0   0     0 (0.00)    1    1 (14.29)
 7      1    418      6 (  1.42)     0  0    0   0   0   0     0 (0.00)    1    1 (16.67)
 6      2    420      5 (  1.18)     0  0    0   0   0   0     0 (0.00)    1    1 (20.00)
 4      2    422      3 (  0.71)     0  0    0   0   0   0     0 (0.00)    1    1 (33.33)
 0      1    423      1 (  0.24)     0  0    0   0   1   0     1 (100.00)    2    1 (100.00)
-1      0    423      0 (  0.00)     2  0    0   0   0   0     0 (0.00)    2    0 (0.00)


Read/contig alignment summary, by read base; adjusted qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
90    284    284    423 (100.00)     0  0    0   0   0   0     0 (0.00)    0    2 (0.47)
88      2    286    139 ( 32.86)     0  0    0   0   0   0     0 (0.00)    0    2 (1.44)
87      2    288    137 ( 32.39)     0  0    0   0   0   0     0 (0.00)    0    2 (1.46)
85     26    314    135 ( 31.91)     0  0    0   0   0   0     0 (0.00)    0    2 (1.48)
84      2    316    109 ( 25.77)     0  0    0   0   0   0     0 (0.00)    0    2 (1.83)
83      6    322    107 ( 25.30)     0  0    0   0   0   0     0 (0.00)    0    2 (1.87)
82     10    332    101 ( 23.88)     0  0    0   0   0   0     0 (0.00)    0    2 (1.98)
81      4    336     91 ( 21.51)     0  0    0   0   0   0     0 (0.00)    0    2 (2.20)
80      4    340     87 ( 20.57)     0  0    0   0   0   0     0 (0.00)    0    2 (2.30)
79      4    344     83 ( 19.62)     0  0    0   0   0   0     0 (0.00)    0    2 (2.41)
73      2    346     79 ( 18.68)     0  0    0   0   0   0     0 (0.00)    0    2 (2.53)
71      7    353     77 ( 18.20)     0  0    0   0   0   0     0 (0.00)    0    2 (2.60)
69      1    354     70 ( 16.55)     0  0    0   0   0   0     0 (0.00)    0    2 (2.86)
68      4    358     69 ( 16.31)     0  0    0   0   0   0     0 (0.00)    0    2 (2.90)
66      3    361     65 ( 15.37)     0  0    0   0   0   0     0 (0.00)    0    2 (3.08)
63      2    363     62 ( 14.66)     0  0    0   0   0   0     0 (0.00)    0    2 (3.23)
62      2    365     60 ( 14.18)     0  0    0   0   0   0     0 (0.00)    0    2 (3.33)
60      1    366     58 ( 13.71)     0  0    0   0   0   0     0 (0.00)    0    2 (3.45)
59      1    367     57 ( 13.48)     0  0    0   0   0   0     0 (0.00)    0    2 (3.51)
58      2    369     56 ( 13.24)     0  0    0   0   0   0     0 (0.00)    0    2 (3.57)
56      7    376     54 ( 12.77)     0  0    0   0   0   0     0 (0.00)    0    2 (3.70)
55      3    379     47 ( 11.11)     0  0    0   0   0   0     0 (0.00)    0    2 (4.26)
54      1    380     44 ( 10.40)     0  0    0   0   0   0     0 (0.00)    0    2 (4.55)
51      8    388     43 ( 10.17)     0  0    0   0   0   0     0 (0.00)    0    2 (4.65)
48      1    389     35 (  8.27)     0  0    0   0   0   0     0 (0.00)    0    2 (5.71)
45      1    390     34 (  8.04)     0  0    0   0   0   0     0 (0.00)    0    2 (5.88)
43      1    391     33 (  7.80)     0  0    0   0   0   0     0 (0.00)    0    2 (6.06)
42      2    393     32 (  7.57)     0  0    0   0   0   0     0 (0.00)    0    2 (6.25)
41      1    394     30 (  7.09)     0  0    0   0   0   0     0 (0.00)    0    2 (6.67)
40      2    396     29 (  6.86)     0  0    0   0   0   0     0 (0.00)    0    2 (6.90)
37      1    397     27 (  6.38)     0  0    0   0   0   0     0 (0.00)    0    2 (7.41)
34      2    399     26 (  6.15)     0  0    0   0   0   0     0 (0.00)    0    2 (7.69)
33      1    400     24 (  5.67)     0  0    0   0   0   0     0 (0.00)    0    2 (8.33)
30      1    401     23 (  5.44)     0  0    0   0   0   0     0 (0.00)    0    2 (8.70)
28      1    402     22 (  5.20)     0  0    0   0   0   0     0 (0.00)    0    2 (9.09)
24      4    406     21 (  4.96)     0  0    0   0   0   0     0 (0.00)    0    2 (9.52)
23      1    407     17 (  4.02)     0  0    0   0   0   0     0 (0.00)    0    2 (11.76)
22      1    408     16 (  3.78)     0  0    0   0   0   0     0 (0.00)    0    2 (12.50)
18      2    410     15 (  3.55)     0  0    0   0   0   0     0 (0.00)    0    2 (13.33)
15      2    412     13 (  3.07)     0  0    0   0   0   0     0 (0.00)    0    2 (15.38)
13      1    413     11 (  2.60)     0  0    0   0   0   0     0 (0.00)    0    2 (18.18)
12      1    414     10 (  2.36)     0  0    0   1   0   0     1 (100.00)    1    2 (20.00)
11      1    415      9 (  2.13)     0  0    0   0   0   0     0 (0.00)    1    1 (11.11)
 9      3    418      8 (  1.89)     0  0    0   0   0   0     0 (0.00)    1    1 (12.50)
 6      2    420      5 (  1.18)     0  0    0   0   0   0     0 (0.00)    1    1 (20.00)
 4      2    422      3 (  0.71)     0  0    0   0   0   0     0 (0.00)    1    1 (33.33)
 0      1    423      1 (  0.24)     0  0    0   0   1   0     1 (100.00)    2    1 (100.00)
-1      0    423      0 (  0.00)     2  0    0   0   0   0     0 (0.00)    2    0 (0.00)


Depth 0 regions:

Block histogram:
Qual   bases    cum    blocks
 18       2        2        1
 24       2        4        1
 33       1        5        1
 45       1        6        1
 51       7       13        2
 55       1       14        2
 56       7       21        4
 58       2       23        4
 60       1       24        5
 62       1       25        6
 63       2       27        6
 66       3       30        6
 68       2       32        5
 71       7       39        4
 73       1       40        4
 79       2       42        5
 80       2       44        6
 81       2       46        5
 82       5       51        7
 83       3       54        8
 84       1       55        7
 85      13       68        7
 87       1       69        8
 88       1       70        8
 90     142      212        1

SS region: 2 (0.94%), flagged: 0 (0.00%)

Sites with total LLR scores < -3.0  [max pos LLR read, max neg LLR read]  (#discrep top reads, #discrep bottom reads):
  212     -4.0  [-4.0,  0.0]  (0, 1)

Read/contig discrepancies (* = higher-quality): None.
0 lower quality discrepant sites.

Reads with neg LLR score, or confirmed or high-qual unaligned seg > 20 bases, or other problem: None.

Gaps in unique-read coverage:   E 3- 212

Contig 12.  2 reads; 488 bp (untrimmed), 488 (trimmed).
C  -519   535 ed050109r1    474 (455)  0.00 0.00 0.00  520 (527)   47 ( 47) 
     -5  1055 ed050109f1    467 (453)  0.00 0.00 0.00   13 ( 13)  567 (567) 

Overall discrep rates (%):             0.00 0.00 0.00

Contig quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 90     433  88.7     433  88.7    0.00
 89       1   0.2     434  88.9    0.00
 88       7   1.4     441  90.4    0.00
 87       1   0.2     442  90.6    0.00
 86       8   1.6     450  92.2    0.00
 85       6   1.2     456  93.4    0.00
 84       2   0.4     458  93.9    0.00
 83       2   0.4     460  94.3    0.00
 81       2   0.4     462  94.7    0.00
 80       3   0.6     465  95.3    0.00
 79       1   0.2     466  95.5    0.00
 78       1   0.2     467  95.7    0.00
 74       2   0.4     469  96.1    0.00
 73       1   0.2     470  96.3    0.00
 72       1   0.2     471  96.5    0.00
 71       3   0.6     474  97.1    0.00
 66       3   0.6     477  97.7    0.00
 56       4   0.8     481  98.6    0.00
 51       3   0.6     484  99.2    0.00
 45       4   0.8     488 100.0    0.00   (quality -1 = terminal quality 0)

Avg. full length: 488.0, trimmed (qual > -1): 488.0
Avg. quality: 88.3 per base

Initial, terminal qual 0 segments:  (None), (None)

Regions of LLR- adjusted quality < 2.0:


1 regions, avg size 0.0, avg spacing 488.0

First_start: 8, last_end: 488

Slack, # used pairs (max_score), unused
 0     1  (10.7)     0 ( 0.0)        1

LLR histograms (used, unused pairs): 

   DS Gap         Size      Closest read (Start)   Covers   Read length required
                                                    now?        to cover
Top strand: 
 left -     7        7+
  489 - right        0+      ed050109f1   (  -5)    No            493+

Bottom strand: 
 left -     0        0+      ed050109r1   ( 535)    Yes           535+
  489 - right        0+

Read/contig alignment summary, by read base; trace qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
56    578    578    969 (100.00)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
51    166    744    391 ( 40.35)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
50      3    747    225 ( 23.22)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
47      2    749    222 ( 22.91)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
46     10    759    220 ( 22.70)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
45     47    806    210 ( 21.67)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
44      6    812    163 ( 16.82)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
43     22    834    157 ( 16.20)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
42     13    847    135 ( 13.93)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
41      2    849    122 ( 12.59)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
40     27    876    120 ( 12.38)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
38      1    877     93 (  9.60)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
37     14    891     92 (  9.49)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
35     42    933     78 (  8.05)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
34      4    937     36 (  3.72)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
33      0    937     32 (  3.30)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
32      6    943     32 (  3.30)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
31      0    943     26 (  2.68)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
30      0    943     26 (  2.68)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
29      9    952     26 (  2.68)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
27      1    953     17 (  1.75)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
25      3    956     16 (  1.65)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
24      3    959     13 (  1.34)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
23      3    962     10 (  1.03)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
22      1    963      7 (  0.72)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
21      0    963      6 (  0.62)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
20      0    963      6 (  0.62)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
19      0    963      6 (  0.62)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
18      2    965      6 (  0.62)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
17      1    966      4 (  0.41)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
16      2    968      3 (  0.31)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
15      1    969      1 (  0.10)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
14      0    969      0 (  0.00)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
12      0    969      0 (  0.00)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
11      0    969      0 (  0.00)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
10      0    969      0 (  0.00)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
 9      0    969      0 (  0.00)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
-1      0    969      0 (  0.00)     7  0    0   0   0   0     0 (0.00)    0    0 (0.00)


Read/contig alignment summary, by read base; adjusted qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
90    866    866    969 (100.00)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
89      2    868    103 ( 10.63)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
88     14    882    101 ( 10.42)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
87      2    884     87 (  8.98)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
86     16    900     85 (  8.77)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
85     12    912     69 (  7.12)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
84      4    916     57 (  5.88)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
83      4    920     53 (  5.47)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
81      4    924     49 (  5.06)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
80      6    930     45 (  4.64)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
79      2    932     39 (  4.02)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
78      2    934     37 (  3.82)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
74      4    938     35 (  3.61)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
73      2    940     31 (  3.20)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
72      2    942     29 (  2.99)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
71      4    946     27 (  2.79)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
66      3    949     23 (  2.37)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
56      4    953     20 (  2.06)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
51      3    956     16 (  1.65)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
45      4    960     13 (  1.34)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
44      3    963      9 (  0.93)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
38      2    965      6 (  0.62)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
33      0    965      4 (  0.41)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
29      2    967      4 (  0.41)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
25      1    968      2 (  0.21)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
16      1    969      1 (  0.10)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
-1      0    969      0 (  0.00)     7  0    0   0   0   0     0 (0.00)    0    0 (0.00)


Depth 0 regions:

Block histogram:
Qual   bases    cum    blocks
 45       4        4        1
 51       3        7        1
 56       4       11        2
 66       3       14        2
 71       3       17        3
 72       1       18        3
 73       1       19        3
 74       2       21        4
 78       1       22        4
 79       1       23        4
 80       3       26        5
 81       2       28        4
 83       2       30        5
 84       2       32        6
 85       6       38        6
 86       8       46        8
 87       1       47        9
 88       7       54        8
 89       1       55        8
 90     433      488        1

SS region: 7 (1.43%), flagged: 0 (0.00%)

Sites with total LLR scores < -3.0  [max pos LLR read, max neg LLR read]  (#discrep top reads, #discrep bottom reads):
  488     -3.3  [-3.3,  0.0]  (0, 1)

Read/contig discrepancies (* = higher-quality): None.
0 lower quality discrepant sites.

Reads with neg LLR score, or confirmed or high-qual unaligned seg > 20 bases, or other problem: None.

Gaps in unique-read coverage:   E 8- 488

Contig 13.  2 reads; 50 bp (untrimmed), 0 (trimmed).  Isolated contig.
      0  1080 bg030109r1     30 (  0)  7.32 0.00 0.00   10 ( 20) 1030 (1030) 
      1  1082 bb070109r1     48 (  0)  0.00 0.00 0.00    0 ( 19) 1032 (1032) 

Overall discrep rates (%):             3.30 0.00 0.00

Contig quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 -1      50 100.0      50 100.0   50.00   (quality -1 = terminal quality 0)

Avg. full length: 50.0, trimmed (qual > -1): 0.0
Avg. quality: 0.0 per base

Initial, terminal qual 0 segments:  1-50, (None)

Regions of LLR- adjusted quality < 2.0:
1-50, 

1 regions, avg size 50.0, avg spacing 50.0

First_start: 20, last_end: 50

Slack, # used pairs (max_score), unused
 0     1  ( 0.0)     0 ( 0.0)        1

LLR histograms (used, unused pairs): 

   DS Gap         Size      Closest read (Start)   Covers   Read length required
                                                    now?        to cover
Top strand: 
 left -     0        0+
   51 - right        0+      bb070109r1   (   1)    No             49+

Bottom strand: 
 left - right       50+

Read/contig alignment summary, by read base; trace qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
48      6      6     82 (100.00)     0  0    0   0   0   0     0 (0.00)    0    3 (3.66)
40      6     12     76 ( 92.68)     0  0    0   0   0   0     0 (0.00)    0    3 (3.95)
34      1     13     70 ( 85.37)     0  0    0   0   0   0     0 (0.00)    0    3 (4.29)
32      3     16     69 ( 84.15)     0  0    0   0   0   0     0 (0.00)    0    3 (4.35)
31      1     17     66 ( 80.49)     0  0    0   0   0   0     0 (0.00)    0    3 (4.55)
26      1     18     65 ( 79.27)     0  0    0   0   0   0     0 (0.00)    0    3 (4.62)
25      4     22     64 ( 78.05)     0  0    0   0   0   0     0 (0.00)    0    3 (4.69)
24      1     23     60 ( 73.17)     0  0    0   0   0   0     0 (0.00)    0    3 (5.00)
23      1     24     59 ( 71.95)     0  0    0   0   0   0     0 (0.00)    0    3 (5.08)
20      3     27     58 ( 70.73)     0  0    0   0   0   0     0 (0.00)    0    3 (5.17)
19      4     31     55 ( 67.07)     0  0    0   0   0   0     0 (0.00)    0    3 (5.45)
18      1     32     51 ( 62.20)     0  0    0   0   0   0     0 (0.00)    0    3 (5.88)
17      1     33     50 ( 60.98)     0  0    0   0   0   0     0 (0.00)    0    3 (6.00)
16      2     35     49 ( 59.76)     0  0    0   0   0   0     0 (0.00)    0    3 (6.12)
15      4     39     47 ( 57.32)     0  0    0   0   0   0     0 (0.00)    0    3 (6.38)
14      2     41     43 ( 52.44)     0  0    0   0   0   0     0 (0.00)    0    3 (6.98)
13      2     43     41 ( 50.00)     0  0    0   0   0   0     0 (0.00)    0    3 (7.32)
12      4     47     39 ( 47.56)     0  0    0   0   0   0     0 (0.00)    0    3 (7.69)
11      1     48     35 ( 42.68)     0  0    0   0   0   0     0 (0.00)    0    3 (8.57)
10      7     55     34 ( 41.46)     0  0    0   0   0   0     0 (0.00)    0    3 (8.82)
 9     10     65     27 ( 32.93)     0  0    0   0   0   0     0 (0.00)    0    3 (11.11)
 8      4     69     17 ( 20.73)     0  0    0   0   0   0     0 (0.00)    0    3 (17.65)
 7     10     79     13 ( 15.85)     0  0    0   3   0   0     3 (30.00)    3    3 (23.08)
 6      2     81      3 (  3.66)     0  0    0   0   0   0     0 (0.00)    3    0 (0.00)
 4      1     82      1 (  1.22)     0  0    0   0   0   0     0 (0.00)    3    0 (0.00)
-1      9     91      0 (  0.00)     9  0    0   0   0   0     0 (0.00)    3    0 (0.00)


Read/contig alignment summary, by read base; adjusted qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
-1     91     91      0 (  0.00)     9  0    0   3   0   0     3 (3.30)    3    0 (0.00)


Depth 0 regions:

Block histogram:
Qual   bases    cum    blocks
  0      50       50        1

SS region: 50 (100.00%), flagged: 0 (0.00%)

Sites with total LLR scores < -3.0  [max pos LLR read, max neg LLR read]  (#discrep top reads, #discrep bottom reads): None.

Read/contig discrepancies (* = higher-quality):
    14  S     bg030109r1      (0)/(0)  13 GAC / GTC
    19  S     bg030109r1      (0)/(0)  17 GGTG / GTGG

0 HQ discrepancies in 0 reads.
2 lower quality discrepant sites.

Reads with neg LLR score, or confirmed or high-qual unaligned seg > 20 bases, or other problem: None.

Gaps in unique-read coverage:  None.

Contig 14.  2 reads; 253 bp (untrimmed), 253 (trimmed).
C  -797   302 ad060109r1    218 (  0)  1.98 0.00 0.40  798 (805)   49 ( 49) 
    -13  1098 ad060109f1    218 ( 32)  0.81 0.00 0.41   21 ( 21)  845 (845) 

Overall discrep rates (%):             1.40 0.00 0.40

Contig quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 90      69  27.3      69  27.3    0.00
 89       6   2.4      75  29.6    0.00
 88       2   0.8      77  30.4    0.00
 87       2   0.8      79  31.2    0.00
 86       4   1.6      83  32.8    0.00
 85       7   2.8      90  35.6    0.00
 84       7   2.8      97  38.3    0.00
 82       2   0.8      99  39.1    0.00
 81       2   0.8     101  39.9    0.00
 79       7   2.8     108  42.7    0.00
 78       1   0.4     109  43.1    0.00
 77       1   0.4     110  43.5    0.00
 76       1   0.4     111  43.9    0.00
 75       4   1.6     115  45.5    0.00
 74       2   0.8     117  46.2    0.00
 73       1   0.4     118  46.6    0.00
 72       2   0.8     120  47.4    0.00
 71      56  22.1     176  69.6    0.00
 70       1   0.4     177  70.0    0.00
 69       2   0.8     179  70.8    0.00
 67       3   1.2     182  71.9    0.00
 66       1   0.4     183  72.3    0.00
 65       1   0.4     184  72.7    0.00
 62       3   1.2     187  73.9    0.00
 61       1   0.4     188  74.3    0.00
 58       2   0.8     190  75.1    0.00
 57       7   2.8     197  77.9    0.00
 56      13   5.1     210  83.0    0.00
 55       5   2.0     215  85.0    0.00
 52       1   0.4     216  85.4    0.00
 51       4   1.6     220  87.0    0.00
 50       8   3.2     228  90.1    0.00
 46       1   0.4     229  90.5    0.00
 45       1   0.4     230  90.9    0.00
 44       2   0.8     232  91.7    0.00
 43       3   1.2     235  92.9    0.00
 42       3   1.2     238  94.1    0.00
 40       2   0.8     240  94.9    0.00
 39       1   0.4     241  95.3    0.00
 37       6   2.4     247  97.6    0.00
 36       2   0.8     249  98.4    0.00
 35       1   0.4     250  98.8    0.00
 17       3   1.2     253 100.0    0.06   (quality -1 = terminal quality 0)

Avg. full length: 253.0, trimmed (qual > -1): 253.0
Avg. quality: 72.2 per base

Initial, terminal qual 0 segments:  (None), (None)

Regions of LLR- adjusted quality < 2.0:
182-184, 

2 regions, avg size 1.5, avg spacing 126.5

First_start: 8, last_end: 253

Slack, # used pairs (max_score), unused
 0     1  ( 5.2)     0 ( 0.0)        1

LLR histograms (used, unused pairs): 

   DS Gap         Size      Closest read (Start)   Covers   Read length required
                                                    now?        to cover
Top strand: 
 left -     7        7+
  254 - right        0+      ad060109f1   ( -13)    No            266+

Bottom strand: 
 left -     0        0+      ad060109r1   ( 302)    Yes           302+
  254 - right        0+

Read/contig alignment summary, by read base; trace qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
56    145    145    497 (100.00)     0  0    0   0   0   0     0 (0.00)    0    9 (1.81)
51     11    156    352 ( 70.82)     0  0    0   0   0   0     0 (0.00)    0    9 (2.56)
50     19    175    341 ( 68.61)     0  0    0   0   0   0     0 (0.00)    0    9 (2.64)
48      8    183    322 ( 64.79)     0  0    0   0   0   0     0 (0.00)    0    9 (2.80)
47     18    201    314 ( 63.18)     0  0    0   0   0   0     0 (0.00)    0    9 (2.87)
46      7    208    296 ( 59.56)     0  0    0   0   0   0     0 (0.00)    0    9 (3.04)
45      3    211    289 ( 58.15)     0  0    0   0   0   0     0 (0.00)    0    9 (3.11)
44     14    225    286 ( 57.55)     0  0    0   0   0   0     0 (0.00)    0    9 (3.15)
43      7    232    272 ( 54.73)     0  0    0   0   0   0     0 (0.00)    0    9 (3.31)
42     73    305    265 ( 53.32)     0  0    0   0   0   0     0 (0.00)    0    9 (3.40)
40     30    335    192 ( 38.63)     0  0    0   0   0   0     0 (0.00)    0    9 (4.69)
39      6    341    162 ( 32.60)     0  0    0   0   0   0     0 (0.00)    0    9 (5.56)
38      2    343    156 ( 31.39)     0  0    0   0   0   0     0 (0.00)    0    9 (5.77)
37     27    370    154 ( 30.99)     0  0    0   0   0   0     0 (0.00)    0    9 (5.84)
36      3    373    127 ( 25.55)     0  0    0   0   0   0     0 (0.00)    0    9 (7.09)
35     16    389    124 ( 24.95)     0  0    0   0   0   0     0 (0.00)    0    9 (7.26)
34      6    395    108 ( 21.73)     0  0    0   0   0   0     0 (0.00)    0    9 (8.33)
33      8    403    102 ( 20.52)     0  0    0   0   0   0     0 (0.00)    0    9 (8.82)
32      3    406     94 ( 18.91)     0  0    0   0   0   0     0 (0.00)    0    9 (9.57)
31      4    410     91 ( 18.31)     0  0    0   0   0   0     0 (0.00)    0    9 (9.89)
30      2    412     87 ( 17.51)     0  0    0   0   0   0     0 (0.00)    0    9 (10.34)
29      9    421     85 ( 17.10)     0  0    0   0   0   0     0 (0.00)    0    9 (10.59)
28      2    423     76 ( 15.29)     0  0    0   0   0   0     0 (0.00)    0    9 (11.84)
27      8    431     74 ( 14.89)     0  0    0   0   0   0     0 (0.00)    0    9 (12.16)
26      2    433     66 ( 13.28)     0  0    0   0   0   0     0 (0.00)    0    9 (13.64)
25      3    436     64 ( 12.88)     0  0    0   0   0   0     0 (0.00)    0    9 (14.06)
24      1    437     61 ( 12.27)     0  0    0   0   0   0     0 (0.00)    0    9 (14.75)
23      3    440     60 ( 12.07)     0  0    0   0   0   0     0 (0.00)    0    9 (15.00)
22      0    440     57 ( 11.47)     0  0    0   0   0   0     0 (0.00)    0    9 (15.79)
21      3    443     57 ( 11.47)     0  0    0   0   0   0     0 (0.00)    0    9 (15.79)
20      1    444     54 ( 10.87)     0  0    0   0   0   0     0 (0.00)    0    9 (16.67)
19      5    449     53 ( 10.66)     0  0    0   0   0   0     0 (0.00)    0    9 (16.98)
18      3    452     48 (  9.66)     0  0    0   0   0   0     0 (0.00)    0    9 (18.75)
17      4    456     45 (  9.05)     0  0    0   0   0   0     0 (0.00)    0    9 (20.00)
16      3    459     41 (  8.25)     0  0    0   0   0   0     0 (0.00)    0    9 (21.95)
15      3    462     38 (  7.65)     0  0    0   0   0   0     0 (0.00)    0    9 (23.68)
14      3    465     35 (  7.04)     0  0    0   0   0   0     0 (0.00)    0    9 (25.71)
13      7    472     32 (  6.44)     0  0    0   0   0   0     0 (0.00)    0    9 (28.12)
12      6    478     25 (  5.03)     0  0    0   0   0   1     1 (16.67)    1    9 (36.00)
11      6    484     19 (  3.82)     0  0    0   2   0   0     2 (33.33)    3    8 (42.11)
10      5    489     13 (  2.62)     0  0    0   2   0   0     2 (40.00)    5    6 (46.15)
 9      4    493      8 (  1.61)     0  0    0   0   0   1     1 (25.00)    6    4 (50.00)
 8      4    497      4 (  0.80)     0  0    0   3   0   0     3 (75.00)    9    3 (75.00)
-1      0    497      0 (  0.00)     7  0    0   0   0   0     0 (0.00)    9    0 (0.00)


Read/contig alignment summary, by read base; adjusted qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
90    138    138    497 (100.00)     0  0    0   0   0   0     0 (0.00)    0    9 (1.81)
89     12    150    359 ( 72.23)     0  0    0   0   0   0     0 (0.00)    0    9 (2.51)
88      4    154    347 ( 69.82)     0  0    0   0   0   0     0 (0.00)    0    9 (2.59)
87      4    158    343 ( 69.01)     0  0    0   0   0   0     0 (0.00)    0    9 (2.62)
86      8    166    339 ( 68.21)     0  0    0   0   0   0     0 (0.00)    0    9 (2.65)
85     14    180    331 ( 66.60)     0  0    0   0   0   0     0 (0.00)    0    9 (2.72)
84     14    194    317 ( 63.78)     0  0    0   0   0   0     0 (0.00)    0    9 (2.84)
82      4    198    303 ( 60.97)     0  0    0   0   0   0     0 (0.00)    0    9 (2.97)
81      4    202    299 ( 60.16)     0  0    0   0   0   0     0 (0.00)    0    9 (3.01)
79     14    216    295 ( 59.36)     0  0    0   0   0   0     0 (0.00)    0    9 (3.05)
78      2    218    281 ( 56.54)     0  0    0   0   0   0     0 (0.00)    0    9 (3.20)
77      2    220    279 ( 56.14)     0  0    0   0   0   0     0 (0.00)    0    9 (3.23)
76      2    222    277 ( 55.73)     0  0    0   0   0   0     0 (0.00)    0    9 (3.25)
75      8    230    275 ( 55.33)     0  0    0   0   0   0     0 (0.00)    0    9 (3.27)
74      4    234    267 ( 53.72)     0  0    0   0   0   0     0 (0.00)    0    9 (3.37)
73      2    236    263 ( 52.92)     0  0    0   0   0   0     0 (0.00)    0    9 (3.42)
72      4    240    261 ( 52.52)     0  0    0   0   0   0     0 (0.00)    0    9 (3.45)
71     61    301    257 ( 51.71)     0  0    0   0   0   0     0 (0.00)    0    9 (3.50)
70      2    303    196 ( 39.44)     0  0    0   0   0   0     0 (0.00)    0    9 (4.59)
69      6    309    194 ( 39.03)     0  0    0   0   0   0     0 (0.00)    0    9 (4.64)
68      1    310    188 ( 37.83)     0  0    0   0   0   0     0 (0.00)    0    9 (4.79)
67      6    316    187 ( 37.63)     0  0    0   0   0   0     0 (0.00)    0    9 (4.81)
66      1    317    181 ( 36.42)     0  0    0   0   0   0     0 (0.00)    0    9 (4.97)
65      1    318    180 ( 36.22)     0  0    0   0   0   0     0 (0.00)    0    9 (5.00)
63      5    323    179 ( 36.02)     0  0    0   0   0   0     0 (0.00)    0    9 (5.03)
62      4    327    174 ( 35.01)     0  0    0   0   0   0     0 (0.00)    0    9 (5.17)
61      1    328    170 ( 34.21)     0  0    0   0   0   0     0 (0.00)    0    9 (5.29)
59      3    331    169 ( 34.00)     0  0    0   0   0   0     0 (0.00)    0    9 (5.33)
58      3    334    166 ( 33.40)     0  0    0   0   0   0     0 (0.00)    0    9 (5.42)
57     12    346    163 ( 32.80)     0  0    0   0   0   0     0 (0.00)    0    9 (5.52)
56     14    360    151 ( 30.38)     0  0    0   0   0   0     0 (0.00)    0    9 (5.96)
55     14    374    137 ( 27.57)     0  0    0   0   0   0     0 (0.00)    0    9 (6.57)
54      1    375    123 ( 24.75)     0  0    0   0   0   0     0 (0.00)    0    9 (7.32)
53      1    376    122 ( 24.55)     0  0    0   0   0   0     0 (0.00)    0    9 (7.38)
52      4    380    121 ( 24.35)     0  0    0   0   0   0     0 (0.00)    0    9 (7.44)
51      5    385    117 ( 23.54)     0  0    0   0   0   0     0 (0.00)    0    9 (7.69)
50     12    397    112 ( 22.54)     0  0    0   0   0   0     0 (0.00)    0    9 (8.04)
49      6    403    100 ( 20.12)     0  0    0   0   0   0     0 (0.00)    0    9 (9.00)
48      4    407     94 ( 18.91)     0  0    0   0   0   0     0 (0.00)    0    9 (9.57)
47      2    409     90 ( 18.11)     0  0    0   0   0   0     0 (0.00)    0    9 (10.00)
46      4    413     88 ( 17.71)     0  0    0   0   0   0     0 (0.00)    0    9 (10.23)
45      2    415     84 ( 16.90)     0  0    0   0   0   0     0 (0.00)    0    9 (10.71)
44      8    423     82 ( 16.50)     0  0    0   0   0   0     0 (0.00)    0    9 (10.98)
43      3    426     74 ( 14.89)     0  0    0   0   0   0     0 (0.00)    0    9 (12.16)
42      7    433     71 ( 14.29)     0  0    0   0   0   0     0 (0.00)    0    9 (12.68)
41      1    434     64 ( 12.88)     0  0    0   0   0   0     0 (0.00)    0    9 (14.06)
40      2    436     63 ( 12.68)     0  0    0   0   0   0     0 (0.00)    0    9 (14.29)
39      1    437     61 ( 12.27)     0  0    0   0   0   0     0 (0.00)    0    9 (14.75)
38      3    440     60 ( 12.07)     0  0    0   0   0   0     0 (0.00)    0    9 (15.00)
37      8    448     57 ( 11.47)     0  0    0   0   0   0     0 (0.00)    0    9 (15.79)
36      5    453     49 (  9.86)     0  0    0   0   0   0     0 (0.00)    0    9 (18.37)
35      1    454     44 (  8.85)     0  0    0   0   0   0     0 (0.00)    0    9 (20.45)
32      1    455     43 (  8.65)     0  0    0   0   0   0     0 (0.00)    0    9 (20.93)
31      2    457     42 (  8.45)     0  0    0   0   0   0     0 (0.00)    0    9 (21.43)
30      1    458     40 (  8.05)     0  0    0   0   0   0     0 (0.00)    0    9 (22.50)
29      1    459     39 (  7.85)     0  0    0   0   0   0     0 (0.00)    0    9 (23.08)
28      1    460     38 (  7.65)     0  0    0   0   0   0     0 (0.00)    0    9 (23.68)
27      1    461     37 (  7.44)     0  0    0   0   0   0     0 (0.00)    0    9 (24.32)
26      1    462     36 (  7.24)     0  0    0   0   0   0     0 (0.00)    0    9 (25.00)
23      1    463     35 (  7.04)     0  0    0   0   0   0     0 (0.00)    0    9 (25.71)
19      2    465     34 (  6.84)     0  0    0   0   0   0     0 (0.00)    0    9 (26.47)
17      3    468     32 (  6.44)     0  0    0   0   0   0     0 (0.00)    0    9 (28.12)
15      1    469     29 (  5.84)     0  0    0   0   0   0     0 (0.00)    0    9 (31.03)
14      1    470     28 (  5.63)     0  0    0   0   0   0     0 (0.00)    0    9 (32.14)
13      3    473     27 (  5.43)     0  0    0   0   0   0     0 (0.00)    0    9 (33.33)
12      5    478     24 (  4.83)     0  0    0   0   0   1     1 (20.00)    1    9 (37.50)
11      6    484     19 (  3.82)     0  0    0   2   0   0     2 (33.33)    3    8 (42.11)
10      5    489     13 (  2.62)     0  0    0   2   0   0     2 (40.00)    5    6 (46.15)
 9      4    493      8 (  1.61)     0  0    0   0   0   1     1 (25.00)    6    4 (50.00)
 8      4    497      4 (  0.80)     0  0    0   3   0   0     3 (75.00)    9    3 (75.00)
-1      0    497      0 (  0.00)     7  0    0   0   0   0     0 (0.00)    9    0 (0.00)


Depth 0 regions:

Block histogram:
Qual   bases    cum    blocks
 17       3        3        1
 35       1        4        2
 36       2        6        2
 37       6       12        4
 39       1       13        4
 40       2       15        3
 42       3       18        4
 43       3       21        6
 44       2       23        5
 45       1       24        5
 46       1       25        5
 50       8       33        6
 51       4       37        5
 52       1       38        5
 55       5       43        5
 56      13       56        7
 57       7       63        8
 58       2       65        7
 61       1       66        7
 62       3       69        8
 65       1       70        8
 66       1       71        8
 67       3       74        9
 69       2       76        9
 70       1       77       10
 71      56      133       10
 72       2      135       10
 73       1      136        9
 74       2      138       10
 75       4      142        8
 76       1      143        7
 77       1      144        8
 78       1      145        8
 79       7      152        8
 81       2      154        9
 82       2      156       10
 84       7      163       11
 85       7      170       12
 86       4      174       13
 87       2      176       14
 88       2      178       14
 89       6      184       14
 90      69      253        1

SS region: 7 (2.77%), flagged: 0 (0.00%)

Sites with total LLR scores < -3.0  [max pos LLR read, max neg LLR read]  (#discrep top reads, #discrep bottom reads): None.

Read/contig discrepancies (* = higher-quality): None.
0 lower quality discrepant sites.

Reads with neg LLR score, or confirmed or high-qual unaligned seg > 20 bases, or other problem: None.

Gaps in unique-read coverage:  None.

Contig 15.  3 reads; 635 bp (untrimmed), 635 (trimmed).
C  -652   426 ac100109r1    333 (278)  1.60 1.33 0.00  653 (658)   50 ( 98) 
     -8  1119 ac100109f1    344 (301)  1.60 0.53 0.00   10 ( 14)  743 (743) 
      6  1083 bd080109r1    553 (536)  0.86 0.17 0.00   48 ( 48)  448 (707) 

Overall discrep rates (%):             1.28 0.60 0.00

Contig quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 90     216  34.0     216  34.0    0.00
 89       4   0.6     220  34.6    0.00
 87       1   0.2     221  34.8    0.00
 86       4   0.6     225  35.4    0.00
 85       3   0.5     228  35.9    0.00
 84       3   0.5     231  36.4    0.00
 83       1   0.2     232  36.5    0.00
 82       8   1.3     240  37.8    0.00
 81      16   2.5     256  40.3    0.00
 80       2   0.3     258  40.6    0.00
 79       2   0.3     260  40.9    0.00
 76       3   0.5     263  41.4    0.00
 75       9   1.4     272  42.8    0.00
 74       1   0.2     273  43.0    0.00
 73       1   0.2     274  43.1    0.00
 72       1   0.2     275  43.3    0.00
 71       7   1.1     282  44.4    0.00
 70       5   0.8     287  45.2    0.00
 69       1   0.2     288  45.4    0.00
 68       3   0.5     291  45.8    0.00
 66      35   5.5     326  51.3    0.00
 65       1   0.2     327  51.5    0.00
 63       3   0.5     330  52.0    0.00
 62       3   0.5     333  52.4    0.00
 61       8   1.3     341  53.7    0.00
 60       1   0.2     342  53.9    0.00
 59       3   0.5     345  54.3    0.00
 57       2   0.3     347  54.6    0.00
 56     179  28.2     526  82.8    0.00
 54       2   0.3     528  83.1    0.00
 53       3   0.5     531  83.6    0.00
 52       3   0.5     534  84.1    0.00
 51      14   2.2     548  86.3    0.00
 50      22   3.5     570  89.8    0.00
 48       1   0.2     571  89.9    0.00
 46      14   2.2     585  92.1    0.00
 44       5   0.8     590  92.9    0.00
 43      22   3.5     612  96.4    0.00
 42      21   3.3     633  99.7    0.00
 40       2   0.3     635 100.0    0.00   (quality -1 = terminal quality 0)

Avg. full length: 635.0, trimmed (qual > -1): 635.0
Avg. quality: 69.3 per base

Initial, terminal qual 0 segments:  (None), (None)

Regions of LLR- adjusted quality < 2.0:


1 regions, avg size 0.0, avg spacing 635.0

First_start: 6, last_end: 376

Slack, # used pairs (max_score), unused
 0     1  ( 6.9)     0 ( 0.0)        3
 1     1  ( 6.0)     0 ( 0.0)        0
 2     1  ( 7.0)     0 ( 0.0)        0

LLR histograms (used, unused pairs): 

   DS Gap         Size      Closest read (Start)   Covers   Read length required
                                                    now?        to cover
Top strand: 
 left -     1        1+
  636 - right        0+      bd080109r1   (   6)    No            629+

Bottom strand: 
 left -     0        0+      ac100109r1   ( 426)    Yes           426+
  377 - right      259+

Read/contig alignment summary, by read base; trace qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
56    458    458   1341 (100.00)     0  0    0   0   0   0     0 (0.00)    0   25 (1.86)
51     37    495    883 ( 65.85)     0  0    0   0   0   0     0 (0.00)    0   25 (2.83)
50     82    577    846 ( 63.09)     0  0    0   0   0   0     0 (0.00)    0   25 (2.96)
48     15    592    764 ( 56.97)     0  0    0   0   0   0     0 (0.00)    0   25 (3.27)
47     48    640    749 ( 55.85)     2  0    0   0   0   0     0 (0.00)    0   25 (3.34)
46     33    673    701 ( 52.27)     0  0    0   0   0   0     0 (0.00)    0   25 (3.57)
45      6    679    668 ( 49.81)     0  0    0   0   0   0     0 (0.00)    0   25 (3.74)
44     81    760    662 ( 49.37)     1  0    0   0   0   0     0 (0.00)    0   25 (3.78)
43     42    802    581 ( 43.33)     0  0    0   0   0   0     0 (0.00)    0   25 (4.30)
42    122    924    539 ( 40.19)     4  0    0   0   0   0     0 (0.00)    0   25 (4.64)
41      3    927    417 ( 31.10)     0  0    0   0   0   0     0 (0.00)    0   25 (6.00)
40     59    986    414 ( 30.87)     0  0    0   0   0   0     0 (0.00)    0   25 (6.04)
39      0    986    355 ( 26.47)     2  0    0   0   0   0     0 (0.00)    0   25 (7.04)
38      3    989    355 ( 26.47)     0  0    0   0   0   0     0 (0.00)    0   25 (7.04)
37     50   1039    352 ( 26.25)     2  0    0   0   0   0     0 (0.00)    0   25 (7.10)
36      6   1045    302 ( 22.52)     0  0    0   0   0   0     0 (0.00)    0   25 (8.28)
35     12   1057    296 ( 22.07)     0  0    0   0   0   0     0 (0.00)    0   25 (8.45)
34     11   1068    284 ( 21.18)     1  0    0   0   0   0     0 (0.00)    0   25 (8.80)
33     17   1085    273 ( 20.36)     3  0    0   0   0   0     0 (0.00)    0   25 (9.16)
32     15   1100    256 ( 19.09)     0  0    0   0   0   0     0 (0.00)    0   25 (9.77)
31      4   1104    241 ( 17.97)     0  0    0   0   0   0     0 (0.00)    0   25 (10.37)
30      8   1112    237 ( 17.67)     1  0    0   0   0   0     0 (0.00)    0   25 (10.55)
29     20   1132    229 ( 17.08)     1  0    0   0   0   0     0 (0.00)    0   25 (10.92)
28     11   1143    209 ( 15.59)     0  0    0   0   0   0     0 (0.00)    0   25 (11.96)
27      5   1148    198 ( 14.77)     0  0    0   0   0   0     0 (0.00)    0   25 (12.63)
26      6   1154    193 ( 14.39)     0  0    0   0   0   0     0 (0.00)    0   25 (12.95)
25     10   1164    187 ( 13.94)     1  0    0   0   0   0     0 (0.00)    0   25 (13.37)
24      9   1173    177 ( 13.20)     0  0    0   0   0   0     0 (0.00)    0   25 (14.12)
23      9   1182    168 ( 12.53)     1  0    0   0   0   0     0 (0.00)    0   25 (14.88)
22      3   1185    159 ( 11.86)     0  0    0   0   0   0     0 (0.00)    0   25 (15.72)
21      2   1187    156 ( 11.63)     0  0    0   0   0   0     0 (0.00)    0   25 (16.03)
20      7   1194    154 ( 11.48)     0  0    0   0   0   0     0 (0.00)    0   25 (16.23)
19     13   1207    147 ( 10.96)     1  0    0   0   0   0     0 (0.00)    0   25 (17.01)
18      2   1209    134 (  9.99)     0  0    0   0   0   0     0 (0.00)    0   25 (18.66)
17      5   1214    132 (  9.84)     1  0    0   0   0   0     0 (0.00)    0   25 (18.94)
16     11   1225    127 (  9.47)     3  0    0   0   0   0     0 (0.00)    0   25 (19.69)
15     10   1235    116 (  8.65)     3  0    0   0   0   0     0 (0.00)    0   25 (21.55)
14     11   1246    106 (  7.90)     0  0    0   0   0   0     0 (0.00)    0   25 (23.58)
13     13   1259     95 (  7.08)     1  0    0   0   0   0     0 (0.00)    0   25 (26.32)
12      4   1263     82 (  6.11)     1  0    0   0   0   0     0 (0.00)    0   25 (30.49)
11      3   1266     78 (  5.82)     0  0    0   1   0   0     1 (33.33)    1   25 (32.05)
10     12   1278     75 (  5.59)     0  0    0   3   1   0     4 (33.33)    5   24 (32.00)
 9     12   1290     63 (  4.70)     0  0    0   2   1   0     3 (25.00)    8   20 (31.75)
 8     19   1309     51 (  3.80)     0  0    0   5   1   0     6 (31.58)   14   17 (33.33)
 7     15   1324     32 (  2.39)     0  0    0   3   2   0     5 (33.33)   19   11 (34.38)
 6     13   1337     17 (  1.27)     2  0    0   3   3   0     6 (46.15)   25    6 (35.29)
 4      4   1341      4 (  0.30)     0  0    0   0   0   0     0 (0.00)   25    0 (0.00)
-1      0   1341      0 (  0.00)   327  0    0   0   0   0     0 (0.00)   25    0 (0.00)


Read/contig alignment summary, by read base; adjusted qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
90    595    595   1289 (100.00)     0  0    0   0   0   0     0 (0.00)    0   15 (1.16)
89     11    606    694 ( 53.84)     0  0    0   0   0   0     0 (0.00)    0   15 (2.16)
87      2    608    683 ( 52.99)     0  0    0   0   0   0     0 (0.00)    0   15 (2.20)
86     11    619    681 ( 52.83)     0  0    0   0   0   0     0 (0.00)    0   15 (2.20)
85      7    626    670 ( 51.98)     0  0    0   0   0   0     0 (0.00)    0   15 (2.24)
84      9    635    663 ( 51.44)     0  0    0   0   0   0     0 (0.00)    0   15 (2.26)
83      3    638    654 ( 50.74)     0  0    0   0   0   0     0 (0.00)    0   15 (2.29)
82     17    655    651 ( 50.50)     0  0    0   0   0   0     0 (0.00)    0   15 (2.30)
81     32    687    634 ( 49.19)     0  0    0   0   0   0     0 (0.00)    0   15 (2.37)
80      4    691    602 ( 46.70)     0  0    0   0   0   0     0 (0.00)    0   15 (2.49)
79      5    696    598 ( 46.39)     0  0    0   0   0   0     0 (0.00)    0   15 (2.51)
78      1    697    593 ( 46.00)     0  0    0   0   0   0     0 (0.00)    0   15 (2.53)
77      1    698    592 ( 45.93)     0  0    0   0   0   0     0 (0.00)    0   15 (2.53)
76      7    705    591 ( 45.85)     0  0    0   0   0   0     0 (0.00)    0   15 (2.54)
75     16    721    584 ( 45.31)     0  0    0   0   0   0     0 (0.00)    0   15 (2.57)
74      3    724    568 ( 44.07)     0  0    0   0   0   0     0 (0.00)    0   15 (2.64)
73      3    727    565 ( 43.83)     0  0    0   0   0   0     0 (0.00)    0   15 (2.65)
72      2    729    562 ( 43.60)     0  0    0   0   0   0     0 (0.00)    0   15 (2.67)
71      9    738    560 ( 43.44)     0  0    0   0   0   0     0 (0.00)    0   15 (2.68)
70     14    752    551 ( 42.75)     0  0    0   0   0   0     0 (0.00)    0   15 (2.72)
69      5    757    537 ( 41.66)     0  0    0   0   0   0     0 (0.00)    0   15 (2.79)
68      6    763    532 ( 41.27)     0  0    0   0   0   0     0 (0.00)    0   15 (2.82)
66     66    829    526 ( 40.81)     0  0    0   0   0   0     0 (0.00)    0   15 (2.85)
65      5    834    460 ( 35.69)     0  0    0   0   0   0     0 (0.00)    0   15 (3.26)
63      5    839    455 ( 35.30)     0  0    0   0   0   0     0 (0.00)    0   15 (3.30)
62      4    843    450 ( 34.91)     0  0    0   0   0   0     0 (0.00)    0   15 (3.33)
61     14    857    446 ( 34.60)     0  0    0   0   0   0     0 (0.00)    0   15 (3.36)
60      2    859    432 ( 33.51)     0  0    0   0   0   0     0 (0.00)    0   15 (3.47)
59      4    863    430 ( 33.36)     0  0    0   0   0   0     0 (0.00)    0   15 (3.49)
57      9    872    426 ( 33.05)     0  0    0   0   0   0     0 (0.00)    0   15 (3.52)
56    180   1052    417 ( 32.35)     0  0    0   0   0   0     0 (0.00)    0   15 (3.60)
55      2   1054    237 ( 18.39)     0  0    0   0   0   0     0 (0.00)    0   15 (6.33)
54     10   1064    235 ( 18.23)     0  0    0   0   0   0     0 (0.00)    0   15 (6.38)
53      6   1070    225 ( 17.46)     0  0    0   0   0   0     0 (0.00)    0   15 (6.67)
52      9   1079    219 ( 16.99)     0  0    0   0   0   0     0 (0.00)    0   15 (6.85)
51     15   1094    210 ( 16.29)     0  0    0   0   0   0     0 (0.00)    0   15 (7.14)
50     23   1117    195 ( 15.13)     0  0    0   0   0   0     0 (0.00)    0   15 (7.69)
48      5   1122    172 ( 13.34)     0  0    0   0   0   0     0 (0.00)    0   15 (8.72)
47      3   1125    167 ( 12.96)     0  0    0   0   0   0     0 (0.00)    0   15 (8.98)
46     14   1139    164 ( 12.72)     0  0    0   0   0   0     0 (0.00)    0   15 (9.15)
45      2   1141    150 ( 11.64)     0  0    0   0   0   0     0 (0.00)    0   15 (10.00)
44     10   1151    148 ( 11.48)     0  0    0   0   0   0     0 (0.00)    0   15 (10.14)
43     23   1174    138 ( 10.71)     0  0    0   0   0   0     0 (0.00)    0   15 (10.87)
42     23   1197    115 (  8.92)     0  0    0   0   0   0     0 (0.00)    0   15 (13.04)
41      3   1200     92 (  7.14)     0  0    0   0   0   0     0 (0.00)    0   15 (16.30)
40     11   1211     89 (  6.90)     0  0    0   0   0   0     0 (0.00)    0   15 (16.85)
39      3   1214     78 (  6.05)     0  0    0   0   0   0     0 (0.00)    0   15 (19.23)
38      1   1215     75 (  5.82)     0  0    0   0   0   0     0 (0.00)    0   15 (20.00)
37      3   1218     74 (  5.74)     0  0    0   0   0   0     0 (0.00)    0   15 (20.27)
36      1   1219     71 (  5.51)     0  0    0   0   0   0     0 (0.00)    0   15 (21.13)
34      1   1220     70 (  5.43)     0  0    0   0   0   0     0 (0.00)    0   15 (21.43)
32      1   1221     69 (  5.35)     0  0    0   0   0   0     0 (0.00)    0   15 (21.74)
31      3   1224     68 (  5.28)     0  0    0   0   0   0     0 (0.00)    0   15 (22.06)
28      1   1225     65 (  5.04)     0  0    0   0   0   0     0 (0.00)    0   15 (23.08)
27      1   1226     64 (  4.97)     0  0    0   0   0   0     0 (0.00)    0   15 (23.44)
23      1   1227     63 (  4.89)     0  0    0   0   0   0     0 (0.00)    0   15 (23.81)
22      1   1228     62 (  4.81)     0  0    0   0   0   0     0 (0.00)    0   15 (24.19)
17      1   1229     61 (  4.73)     0  0    0   0   0   0     0 (0.00)    0   15 (24.59)
16      4   1233     60 (  4.65)     0  0    0   0   0   0     0 (0.00)    0   15 (25.00)
15      1   1234     56 (  4.34)     0  0    0   0   0   0     0 (0.00)    0   15 (26.79)
14      4   1238     55 (  4.27)     0  0    0   0   0   0     0 (0.00)    0   15 (27.27)
13      4   1242     51 (  3.96)     0  0    0   0   0   0     0 (0.00)    0   15 (29.41)
11      2   1244     47 (  3.65)     0  0    0   1   0   0     1 (50.00)    1   15 (31.91)
10     10   1254     45 (  3.49)     0  0    0   3   0   0     3 (30.00)    4   14 (31.11)
 9     12   1266     35 (  2.72)     0  0    0   2   1   0     3 (25.00)    7   11 (31.43)
 8      9   1275     23 (  1.78)     0  0    0   4   0   0     4 (44.44)   11    8 (34.78)
 7      8   1283     14 (  1.09)     0  0    0   2   1   0     3 (37.50)   14    4 (28.57)
 6      4   1287      6 (  0.47)     0  0    0   0   1   0     1 (25.00)   15    1 (16.67)
 4      2   1289      2 (  0.16)     0  0    0   0   0   0     0 (0.00)   15    0 (0.00)
-1     52   1341      0 (  0.00)   358  0    0   5   5   0    10 (19.23)   25    0 (0.00)


Depth 0 regions:

Block histogram:
Qual   bases    cum    blocks
 40       2        2        1
 42      21       23       14
 43      22       45       16
 44       5       50       15
 46      14       64       16
 48       1       65       16
 50      22       87       19
 51      14      101       19
 52       3      104       20
 53       3      107       21
 54       2      109       21
 56     179      288        7
 57       2      290        8
 59       3      293        8
 60       1      294        9
 61       8      302        9
 62       3      305        7
 63       3      308        7
 65       1      309        8
 66      35      344        6
 68       3      347        6
 69       1      348        6
 70       5      353        8
 71       7      360        9
 72       1      361        8
 73       1      362        8
 74       1      363        9
 75       9      372       11
 76       3      375       10
 79       2      377       11
 80       2      379       11
 81      16      395       12
 82       8      403       13
 83       1      404       12
 84       3      407       13
 85       3      410       12
 86       4      414       12
 87       1      415       13
 89       4      419       12
 90     216      635        1

SS region: 260 (40.94%), flagged: 0 (0.00%)

Sites with total LLR scores < -3.0  [max pos LLR read, max neg LLR read]  (#discrep top reads, #discrep bottom reads): None.

Read/contig discrepancies (* = higher-quality): None.
0 lower quality discrepant sites.

Reads with neg LLR score, or confirmed or high-qual unaligned seg > 20 bases, or other problem:

(Lngths init HQ, CF unalgn segs); aligned contig pos [LLR score]; (terminal HQ, CF unalgn); read id; aligned read pos
| confirmed read segments | unaligned read segments matching elsewhere
 (LU = local unaligned, DU = distant unaligned, DA = distant aligned, ** = overlaps trimmed region
 || Best local and distant LLR scores
(0, 0)    54-  635 [12.4] (0,0)     bd080109r1         49-631 | 49 628 | DA:(**373 628**) || local(+/-) (6.9,0.0), distant (12.4,0.0)

Gaps in unique-read coverage:   E 6- 376

Contig 16.  4 reads; 46 bp (untrimmed), 0 (trimmed).  Isolated contig.
      1  1030 ea060109r1     31 (  0)  5.13 0.00 0.00    7 (  7)  984 (984) 
      1  1085 eg080109r1     37 (  0)  2.17 2.17 0.00    0 ( 10) 1039 (1039) 
      1  1036 cb030109r1     39 (  0)  0.00 0.00 2.17    0 (  7)  990 (990) 
      1  1033 cg060109r1     32 (  0)  6.52 0.00 0.00    0 ( 12)  987 (987) 

Overall discrep rates (%):             3.39 0.56 0.56

Contig quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 -1      46 100.0      46 100.0   46.00   (quality -1 = terminal quality 0)

Avg. full length: 46.0, trimmed (qual > -1): 0.0
Avg. quality: 0.0 per base

Initial, terminal qual 0 segments:  1-46, (None)

Regions of LLR- adjusted quality < 2.0:
1-46, 

1 regions, avg size 46.0, avg spacing 46.0

First_start: 8, last_end: 46

Slack, # used pairs (max_score), unused
 0     5  ( 0.0)     0 ( 0.0)        6
 1     1  ( 0.0)     0 ( 0.0)        0

LLR histograms (used, unused pairs): 

   DS Gap         Size      Closest read (Start)   Covers   Read length required
                                                    now?        to cover
Top strand: 
 left -     0        0+
   47 - right        0+      ea060109r1   (   1)    No             45+

Bottom strand: 
 left - right       46+

Read/contig alignment summary, by read base; trace qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
56      3      3    177 (100.00)     0  0    0   0   0   0     0 (0.00)    0    8 (4.52)
46      2      5    174 ( 98.31)     0  0    0   0   0   0     0 (0.00)    0    8 (4.60)
44      1      6    172 ( 97.18)     0  0    0   0   0   0     0 (0.00)    0    8 (4.65)
40      5     11    171 ( 96.61)     0  0    0   0   0   0     0 (0.00)    0    8 (4.68)
37      1     12    166 ( 93.79)     0  0    0   0   0   0     0 (0.00)    0    8 (4.82)
32      8     20    165 ( 93.22)     0  0    0   0   0   0     0 (0.00)    0    8 (4.85)
31      1     21    157 ( 88.70)     0  0    0   0   0   0     0 (0.00)    0    8 (5.10)
28      1     22    156 ( 88.14)     0  0    0   0   0   0     0 (0.00)    0    8 (5.13)
27      6     28    155 ( 87.57)     0  0    0   0   0   0     0 (0.00)    0    8 (5.16)
25      4     32    149 ( 84.18)     0  0    0   0   0   0     0 (0.00)    0    8 (5.37)
24      1     33    145 ( 81.92)     0  0    0   0   0   0     0 (0.00)    0    8 (5.52)
23     11     44    144 ( 81.36)     0  0    0   0   0   0     0 (0.00)    0    8 (5.56)
22      2     46    133 ( 75.14)     0  0    0   0   0   0     0 (0.00)    0    8 (6.02)
21      3     49    131 ( 74.01)     0  0    0   0   0   0     0 (0.00)    0    8 (6.11)
19      5     54    128 ( 72.32)     0  0    0   0   0   0     0 (0.00)    0    8 (6.25)
18      2     56    123 ( 69.49)     0  0    0   0   0   0     0 (0.00)    0    8 (6.50)
17      6     62    121 ( 68.36)     0  0    0   0   0   0     0 (0.00)    0    8 (6.61)
16      5     67    115 ( 64.97)     0  0    0   0   0   0     0 (0.00)    0    8 (6.96)
15     13     80    110 ( 62.15)     0  0    0   0   0   1     1 (7.69)    1    8 (7.27)
14      2     82     97 ( 54.80)     0  0    0   0   0   0     0 (0.00)    1    7 (7.22)
13      4     86     95 ( 53.67)     0  0    0   0   0   0     0 (0.00)    1    7 (7.37)
12      5     91     91 ( 51.41)     0  0    0   0   0   0     0 (0.00)    1    7 (7.69)
11      4     95     86 ( 48.59)     0  0    0   0   0   0     0 (0.00)    1    7 (8.14)
10      4     99     82 ( 46.33)     0  0    0   0   0   0     0 (0.00)    1    7 (8.54)
 9     27    126     78 ( 44.07)     0  0    0   1   0   0     1 (3.70)    2    7 (8.97)
 8      9    135     51 ( 28.81)     0  0    0   2   0   0     2 (22.22)    4    6 (11.76)
 7     15    150     42 ( 23.73)     0  0    0   0   0   0     0 (0.00)    4    4 (9.52)
 6     19    169     27 ( 15.25)     0  0    0   1   1   0     2 (10.53)    6    4 (14.81)
 4      8    177      8 (  4.52)     0  0    0   2   0   0     2 (25.00)    8    2 (25.00)
-1      0    177      0 (  0.00)     7  0    0   0   0   0     0 (0.00)    8    0 (0.00)


Read/contig alignment summary, by read base; adjusted qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
-1    177    177      0 (  0.00)     7  0    0   6   1   1     8 (4.52)    8    0 (0.00)


Depth 0 regions:

Block histogram:
Qual   bases    cum    blocks
  0      46       46        1

SS region: 46 (100.00%), flagged: 0 (0.00%)

Sites with total LLR scores < -3.0  [max pos LLR read, max neg LLR read]  (#discrep top reads, #discrep bottom reads): None.

Read/contig discrepancies (* = higher-quality):
    14  S     ea060109r1      (0)/(0)  12 TCGG / TTCG
     5  I     eg080109r1      (0)/(0)  5 AA / AGA
     9  S     eg080109r1      (0)/(0)  8 CCC / CAC
    16  D     cb030109r1      (0)/(0)  14 GGGT / GGT
     7  S     cg060109r1      (0)/(0)  4 GAATC / GGACC
    12  S     cg060109r1      (0)/(0)  11 GTC / GGC

0 HQ discrepancies in 0 reads.
6 lower quality discrepant sites.

Reads with neg LLR score, or confirmed or high-qual unaligned seg > 20 bases, or other problem: None.

Gaps in unique-read coverage:  None.

Contig 17.  4 reads; 45 bp (untrimmed), 0 (trimmed).  Isolated contig.
      0  1027 eg070109r1     30 (  0)  7.69 0.00 0.00    7 (  7)  982 (982) 
      0  1038 cd100109r1     30 (  0)  7.14 0.00 0.00    4 (  4)  993 (993) 
      1  1032 ef030109r1     34 (  0)  4.65 0.00 0.00    2 (  3)  987 (987) 
      1  1039 cf070109r1     42 (  0)  0.00 0.00 0.00    0 ( 13)  994 (994) 

Overall discrep rates (%):             4.73 0.00 0.00

Contig quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 -1      45 100.0      45 100.0   45.00   (quality -1 = terminal quality 0)

Avg. full length: 45.0, trimmed (qual > -1): 0.0
Avg. quality: 0.0 per base

Initial, terminal qual 0 segments:  1-45, (None)

Regions of LLR- adjusted quality < 2.0:
1-45, 

1 regions, avg size 45.0, avg spacing 45.0

First_start: 4, last_end: 45

Slack, # used pairs (max_score), unused
 0     5  ( 0.0)     0 ( 0.0)        5

LLR histograms (used, unused pairs): 

   DS Gap         Size      Closest read (Start)   Covers   Read length required
                                                    now?        to cover
Top strand: 
 left -     0        0+
   46 - right        0+      ef030109r1   (   1)    No             44+

Bottom strand: 
 left - right       45+

Read/contig alignment summary, by read base; trace qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
56      2      2    167 (100.00)     0  0    0   0   0   0     0 (0.00)    0    8 (4.79)
46      2      4    165 ( 98.80)     0  0    0   0   0   0     0 (0.00)    0    8 (4.85)
40      5      9    163 ( 97.60)     0  0    0   0   0   0     0 (0.00)    0    8 (4.91)
37      1     10    158 ( 94.61)     0  0    0   0   0   0     0 (0.00)    0    8 (5.06)
32      7     17    157 ( 94.01)     0  0    0   0   0   0     0 (0.00)    0    8 (5.10)
30      1     18    150 ( 89.82)     0  0    0   0   0   0     0 (0.00)    0    8 (5.33)
29      2     20    149 ( 89.22)     0  0    0   0   0   0     0 (0.00)    0    8 (5.37)
27      7     27    147 ( 88.02)     0  0    0   0   0   0     0 (0.00)    0    8 (5.44)
25      4     31    140 ( 83.83)     0  0    0   0   0   0     0 (0.00)    0    8 (5.71)
24     10     41    136 ( 81.44)     0  0    0   0   0   0     0 (0.00)    0    8 (5.88)
23      6     47    126 ( 75.45)     0  0    0   0   0   0     0 (0.00)    0    8 (6.35)
22      4     51    120 ( 71.86)     0  0    0   0   0   0     0 (0.00)    0    8 (6.67)
21      2     53    116 ( 69.46)     0  0    0   0   0   0     0 (0.00)    0    8 (6.90)
20      2     55    114 ( 68.26)     0  0    0   0   0   0     0 (0.00)    0    8 (7.02)
19      3     58    112 ( 67.07)     0  0    0   0   0   0     0 (0.00)    0    8 (7.14)
18      2     60    109 ( 65.27)     0  0    0   0   0   0     0 (0.00)    0    8 (7.34)
17      1     61    107 ( 64.07)     0  0    0   0   0   0     0 (0.00)    0    8 (7.48)
16      5     66    106 ( 63.47)     0  0    0   0   0   0     0 (0.00)    0    8 (7.55)
15      9     75    101 ( 60.48)     0  0    0   0   0   0     0 (0.00)    0    8 (7.92)
14      6     81     92 ( 55.09)     0  0    0   0   0   0     0 (0.00)    0    8 (8.70)
13     10     91     86 ( 51.50)     0  0    0   0   0   0     0 (0.00)    0    8 (9.30)
12      1     92     76 ( 45.51)     0  0    0   0   0   0     0 (0.00)    0    8 (10.53)
11      1     93     75 ( 44.91)     0  0    0   0   0   0     0 (0.00)    0    8 (10.67)
10      9    102     74 ( 44.31)     0  0    0   0   0   0     0 (0.00)    0    8 (10.81)
 9     12    114     65 ( 38.92)     0  0    0   0   0   0     0 (0.00)    0    8 (12.31)
 8      8    122     53 ( 31.74)     0  0    0   0   0   0     0 (0.00)    0    8 (15.09)
 7     15    137     45 ( 26.95)     0  0    0   1   0   0     1 (6.67)    1    8 (17.78)
 6     17    154     30 ( 17.96)     0  0    0   1   0   0     1 (5.88)    2    7 (23.33)
 4     12    166     13 (  7.78)     0  0    0   5   0   0     5 (41.67)    7    6 (46.15)
 0      1    167      1 (  0.60)     0  0    1   0   0   0     1 (100.00)    8    1 (100.00)
-1      2    169      0 (  0.00)    11  0    0   0   0   0     0 (0.00)    8    0 (0.00)


Read/contig alignment summary, by read base; adjusted qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
-1    169    169      0 (  0.00)    11  0    1   7   0   0     8 (4.73)    8    0 (0.00)


Depth 0 regions:

Block histogram:
Qual   bases    cum    blocks
  0      45       45        1

SS region: 45 (100.00%), flagged: 0 (0.00%)

Sites with total LLR scores < -3.0  [max pos LLR read, max neg LLR read]  (#discrep top reads, #discrep bottom reads): None.

Read/contig discrepancies (* = higher-quality):
    14  S     eg070109r1      (0)/(0)  10 GGCCGG / GTCGNG
    14  S     cd100109r1      (0)/(0)  10 GGCCGG / GTCGCG
    13  S     ef030109r1      (0)/(0)  10 GGCCG / GTCGG

0 HQ discrepancies in 0 reads.
3 lower quality discrepant sites.

Reads with neg LLR score, or confirmed or high-qual unaligned seg > 20 bases, or other problem: None.

Gaps in unique-read coverage:  None.

Contig 18.  121 reads; 11918 bp (untrimmed), 11838 (trimmed).
      1  1001 ea120109f1    926 (  0)  0.00 0.10 0.00    0 ( 92)    0 (  0) 
     48  1121 eb050109f1    939 (  0)  0.00 0.10 0.00   45 ( 45)    5 (  5) 
    128  1179 ef010109r1    491 (  0)  4.07 0.16 0.00   43 ( 43)  394 (470) 
    206  1215 cd110109r1    861 (  0)  0.00 0.10 0.00   44 ( 44)    6 (  6) 
    382  1422 ee040109f1    891 (  0)  0.00 0.49 0.10   23 ( 23)    0 (  0) 
    526  1567 ec010109r1    871 (  0)  0.40 0.30 0.00   46 ( 46)    3 ( 18) 
C  1249  2308 eb050109r1    897 (182)  0.49 0.59 0.10    0 (  0)   45 (758) 
C  1711  2699 ea120109r1    833 (  0)  0.21 0.74 0.00    0 (240)   46 ( 46) 
C  1715  2805 ef010109f1    705 (  0)  0.48 1.32 0.00  229 (229)   31 ( 31) 
   2399  3456 dg080109r1    915 (  0)  0.30 0.39 0.00   45 ( 45)    0 (  0) 
   2526  3612 ab060109r1    820 (  0)  1.74 0.51 0.20   48 ( 48)   62 (136) 
   2600  3619 eg110109f1    914 (  0)  0.40 0.10 0.00   24 ( 24)    1 (  1) 
   2613  3654 ed100109r1    931 (  0)  0.10 0.10 0.00   42 ( 42)    0 (  0) 
   2841  3904 ba020109f1    769 (  0)  1.85 1.09 0.11   25 ( 25)  119 (207) 
   3065  4082 eh030109f1    940 (  0)  0.10 0.00 0.00   22 ( 22)    0 (  0) 
C  3110  4156 ec010109f1    953 (  0)  0.20 0.29 0.00    2 (  2)   23 ( 23) 
   3221  4241 ea090109f1    941 (  0)  0.10 0.10 0.20   22 ( 22)    0 (  0) 
   3343  4382 ef060109f1    939 (  0)  0.59 0.30 0.10   29 ( 29)    0 (  4) 
C  3400  4417 cd110109f1    936 (  0)  0.00 0.50 0.00    0 (  0)   25 ( 25) 
C  3423  4464 ee040109r1    933 (  0)  0.20 0.40 0.10    0 (  4)   43 ( 43) 
   3610  4589 cb120109r1    899 (  0)  0.11 0.00 0.00   47 ( 47)    0 (  0) 
   3645  4682 cd050109r1    949 (  0)  0.10 0.10 0.00   45 ( 45)    4 (  4) 
   3672  4647 ch010109r1    897 (  0)  0.00 0.11 0.00   47 ( 47)    0 (  0) 
C  3732  4756 eg110109r1    936 (  0)  0.21 0.00 0.00    0 (  0)   51 ( 51) 
   3926  4938 da020109f1    951 (  0)  0.00 0.30 0.00   22 ( 22)    0 (  0) 
C  4007  5063 dg080109f1    983 (  0)  0.48 0.10 0.00    0 (  8)   22 ( 22) 
   4171  5232 ah080109f1    894 (  0)  1.67 0.98 0.10   23 ( 23)   22 (118) 
   4211  5236 cf090109r1    937 ( 91)  0.10 0.10 0.00   48 ( 48)    1 (  1) 
C  4244  5296 ed100109f1    986 (126)  0.10 0.29 0.00    0 (  0)   22 ( 24) 
C  4378  5403 da020109r1    932 (126)  0.61 0.00 0.00    0 (  0)   44 ( 44) 
C  4594  5620 eh030109r1    938 (126)  0.10 0.10 0.00    0 (  0)   45 ( 45) 
C  4614  5604 cb120109f1    924 (126)  0.31 0.00 0.00    0 (  0)   22 ( 22) 
   4646  5667 dh050109f1    947 (126)  0.40 0.00 0.00   25 ( 25)    0 (  0) 
C  4759  5842 ab060109f1    925 (126)  1.45 0.68 0.00   28 ( 28)   21 ( 21) 
   4823  5851 cd010109r1    817 (126)  2.24 0.53 0.00   43 ( 43)   50 (112) 
C  4878  5934 ef060109r1    911 (126)  0.20 0.91 0.00   21 ( 21)   46 ( 46) 
C  4884  5954 cd050109f1    969 (126)  0.10 0.48 0.00    0 (  9)   40 ( 40) 
   4952  5986 eb080109f1    941 (126)  0.49 0.49 0.00   21 ( 21)    3 ( 13) 
C  5131  6158 ea090109r1    948 (126)  0.00 0.10 0.00    0 (  0)   47 ( 47) 
   5190  6236 de020109r1    965 (  0)  0.20 0.10 0.00   45 ( 45)    0 (  0) 
   5201  6268 bc070109f1    931 ( 33)  0.60 0.40 0.00   20 ( 20)   53 ( 52) 
   5233  6249 ch120109f1    901 (  0)  0.92 0.61 0.00   29 ( 29)    8 ( 22) 
   5311  6362 cd040109r1    940 (  0)  0.30 0.70 0.10   45 ( 45)    0 (  0) 
C  5363  6398 dh050109r1    939 (  0)  0.30 0.30 0.00    0 (  0)   47 ( 47) 
   5515  6510 cb110109r1    921 (  0)  0.00 0.11 0.00   45 ( 45)    0 (  0) 
   5575  6572 cg010109f1    896 (  0)  1.13 0.51 0.00   22 ( 22)    0 ( 19) 
   5627  6673 bg100109f1    931 (  0)  1.30 0.20 0.00   26 ( 26)   21 ( 21) 
C  5784  6821 cf090109f1    976 (  0)  0.30 0.20 0.00    0 (  0)   27 ( 27) 
   5840  6875 db030109r1    962 (  0)  0.20 0.10 0.00   45 ( 45)    2 (  2) 
C  5909  6973 ah080109r1    913 (  0)  1.58 0.69 0.10    4 ( 99)   48 ( 48) 
C  5933  6941 ch010109f1    948 (  0)  0.00 0.00 0.00    0 (  0)   44 ( 44) 
C  5943  6987 ba020109r1    859 (  0)  2.13 1.01 0.20   10 ( 66)   49 ( 49) 
   5972  7038 ef040109f1    874 (  0)  0.42 1.37 0.00   31 ( 31)   84 (119) 
C  6168  7203 eb080109r1    960 (  0)  0.20 0.10 0.10    0 (  0)   42 ( 42) 
   6313  7401 dc040109f1    841 (  0)  0.85 1.39 0.11   26 (  2)  127 (181) 
   6316  7363 bh030109f1    918 (  0)  1.49 0.30 0.30   23 (  0)   21 ( 64) 
C  6404  7403 cb110109f1    944 (  0)  0.00 0.31 0.10    1 (  1)   22 ( 22) 
   6418  7447 aa010109f1    813 (  0)  2.13 0.34 0.00   25 ( 29)  115 (163) 
C  6524  7553 cd010109f1    936 (  0)  0.50 0.80 0.00    6 (  6)   20 ( 20) 
C  6879  7926 ef040109r1    864 (  0)  1.32 1.42 0.00   16 (101)   44 ( 44) 
C  7043  8070 aa010109r1    859 (  0)  1.54 0.92 0.10    5 ( 19)   48 ( 48) 
C  7084  8096 ch120109r1    892 (  0)  0.83 0.52 0.00    0 (  0)   44 ( 44) 
C  7097  8145 bg100109r1    883 (  0)  1.03 0.72 0.00   21 ( 55)   53 ( 53) 
C  7180  8231 cd040109f1    972 (  0)  0.29 0.10 0.19    0 (  0)   20 ( 20) 
   7289  8348 bf030109f1    815 (  0)  2.70 0.80 0.60   27 ( 27)   34 (178) 
C  7394  8465 bc070109r1    903 (  0)  0.70 1.10 0.00   26 ( 88)   47 ( 47) 
   7418  8505 ac080109f1    944 (  0)  0.29 0.88 0.00   22 ( 22)   48 ( 44) 
C  7718  8772 bh030109r1    889 (  0)  0.81 1.51 0.00   11 ( 82)   51 ( 19) 
C  7711  8768 dc040109r1    970 (  0)  0.40 0.10 0.00    2 ( 18)   47 ( 17) 
   7801  8916 ag080109r1    938 (  0)  1.84 0.39 0.00   44 ( 44)   39 ( 77) 
C  7907  8946 db030109f1    873 (  0)  1.43 1.02 0.10   28 ( 98)   35 ( 35) 
C  8032  9040 cg010109r1    832 (  0)  0.91 0.23 0.00   81 ( 90)   45 ( 45) 
C  8252  9306 de020109f1    882 (  0)  0.93 0.82 0.10   59 ( 92)   25 ( 25) 
   8296  9330 cg040109f1    980 (  0)  0.10 0.00 0.00   23 ( 23)    0 (  0) 
   8630  9829 bc040109r1    788 (  0)  0.45 1.68 0.00   48 ( 48)  259 (286) 
   8780  9919 ab080109r1    841 (  0)  0.33 0.87 0.00   49 ( 49)  171 (202) 
C  8831  9906 ac080109r1    915 (  0)  0.68 0.98 0.10    0 (  0)   51 ( 51) 
   9057 10087 eh050109r1    893 (  0)  0.92 0.10 0.10   48 ( 48)    5 (  9) 
   9136 10161 bg120109r1    866 (  0)  1.04 0.52 0.10   51 ( 51)   12 ( 35) 
   9246 10266 cd120109f1    940 (  0)  0.10 0.30 0.00   22 ( 26)    3 (  3) 
C  9257 10361 bf030109r1    538 (  0)  4.45 0.15 0.15  385 (433)   46 ( 89) 
C  9361 10385 eh050109f1    908 (  0)  0.20 1.00 0.00    7 (  7)   22 ( 22) 
   9394 10580 aa070109f1     48 (  0)  23.85 2.20 0.73  226 (410)  416 (749) 
   9399 10485 ab070109f1    920 (  0)  0.88 0.78 0.00   22 ( 22)   41 ( 89) 
   9453 10505 bf020109f1    858 (  0)  1.35 0.42 0.10   24 ( 24)   67 (137) 
C  9496 10517 bf120109r1    860 (  0)  0.94 0.52 0.10   11 ( 11)   52 ( 52) 
   9516 10572 ac010109f1    899 (  0)  0.69 0.98 0.00   32 ( 22)    6 (  4) 
   9523 10569 ad010109f1    887 (  0)  0.69 1.27 0.00   24 ( 16)    3 (  1) 
   9826 10856 cb080109f1    922 (  0)  0.00 0.10 0.00   34 ( 34)    0 (  0) 
C  9945 11032 ab080109f1    891 (  0)  0.79 0.49 0.20   47 ( 51)   27 ( 27) 
C 10011 11184 bc040109f1    682 (  0)  3.99 2.35 0.10  171 (285)   26 ( 93) 
C 10011 11138 ag080109f1    869 (  0)  0.97 1.35 0.10   68 (114)   25 ( 25) 
C 10056 11513 bd020109r1    236 (  0)  3.00 0.00 0.00 1131 (1131)   60 ( 60) 
  10092 11192 bd040109r1    702 (  0)  2.52 1.54 0.22   45 ( 45)  145 (266) 
  10178 11213 ba010109f1    818 (  0)  2.00 1.40 0.10   23 ( 23)   11 (111) 
C 10271 11300 cg040109r1    890 (  0)  0.41 0.10 0.00    2 (  2)   45 ( 47) 
  10323 11383 cf100109r1    771 (  0)  1.18 1.29 0.11   43 ( 43)   88 ( 97) 
  10658 11685 db010109f1    783 ( 32)  1.65 0.77 0.22   23 ( 23)   98 ( 98) 
  10674 11790 ea010109f1    489 (  0)  0.93 0.00 0.00   29 ( 33)  553 (567) 
C 10801 11839 cb080109r1    851 (  0)  1.77 0.83 0.00   31 ( 47)   45 ( 45) 
C 10836 11876 cd120109r1    619 (  0)  0.16 0.00 0.00  351 (347)   47 ( 47) 
C 10972 11926 c03hba0166b15_sp601  628 (  0)  1.10 1.65 0.14  217 (  4)   10 ( 10) 
C 10985 11929 c03hba0166b15_sp603  605 (  0)  1.92 2.06 0.00  204 (  0)   12 ( 32) 
C 11008 12069 de030109f1    141 (  0)  0.00 0.00 0.00  756 (756)  151 (151) 
C 11015 11927 c03hba0166b15_sp602  645 (  0)  1.91 0.82 0.00  172 (123)    9 (  9) 
C 11029 12070 ba010109r1    697 (  0)  0.54 0.54 0.00  148 (147)  152 (152) 
C 11121 12205 ab070109r1    676 (  0)  1.48 0.54 0.00   55 (119)  287 (287) 
  11190 12240 df100109r1    651 (  0)  0.29 0.00 0.00   46 ( 46)  322 (322) 
  11206 12346 ac090109f1    617 (  0)  1.49 0.00 0.00   44 ( 86)  428 (428) 
  11287 12304 eh070109r1    568 (  0)  0.17 0.00 0.00   41 ( 45)  386 (386) 
C 11301 12323 db010109r1    558 (  0)  1.13 0.65 0.00    0 (  9)  405 (405) 
  11308 12347 cb030109f1    569 (  0)  0.00 0.00 0.00   21 ( 21)  429 (429) 
  11308 12357 cb020109f1    570 (  0)  0.00 0.00 0.00   20 ( 19)  439 (439) 
C 11385 12420 bh100109f1    429 (  0)  1.03 0.41 0.21   49 ( 62)  502 (502) 
C 11449 12549 ac090109r1    214 (  0)  4.32 4.32 0.81  100 (169)  631 (631) 
C 11514 12555 df100109f1    364 (  0)  0.49 0.49 0.25    0 (  0)  637 (637) 
C 11557 12611 ac010109r1    241 (  0)  3.09 1.85 0.31   38 ( 61)  693 (693) 
C 11568 12609 ad010109r1    215 (  0)  5.14 4.00 0.00    1 (113)  691 (691) 
  11617 12733 bf090109f1    249 (  0)  0.36 0.72 0.00   26 ( 26)  815 (815) 
  11712 12773 de030109r1    142 (  0)  0.00 0.00 0.00   51 ( 51)  855 (855) 
C 11835 12855 bg120109f1     32 (  0)  5.77 3.85 0.00   32 ( 31)  937 (941) 

Overall discrep rates (%):             0.94 0.58 0.05

Contig quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 90    8558  71.8    8558  71.8    0.00
 89       6   0.1    8564  71.9    0.00
 88      12   0.1    8576  72.0    0.00
 87      12   0.1    8588  72.1    0.00
 86       6   0.1    8594  72.1    0.00
 85      10   0.1    8604  72.2    0.00
 84      11   0.1    8615  72.3    0.00
 83       8   0.1    8623  72.4    0.00
 82      11   0.1    8634  72.4    0.00
 81     187   1.6    8821  74.0    0.00
 80       8   0.1    8829  74.1    0.00
 79      13   0.1    8842  74.2    0.00
 78      12   0.1    8854  74.3    0.00
 77      13   0.1    8867  74.4    0.00
 76      32   0.3    8899  74.7    0.00
 75      41   0.3    8940  75.0    0.00
 74      19   0.2    8959  75.2    0.00
 73      15   0.1    8974  75.3    0.00
 72       7   0.1    8981  75.4    0.00
 71      11   0.1    8992  75.4    0.00
 70       6   0.1    8998  75.5    0.00
 69       6   0.1    9004  75.5    0.00
 68       7   0.1    9011  75.6    0.00
 66    1593  13.4   10604  89.0    0.00
 65       9   0.1   10613  89.1    0.00
 64       4   0.0   10617  89.1    0.00
 62       2   0.0   10619  89.1    0.00
 61     372   3.1   10991  92.2    0.00
 60      76   0.6   11067  92.9    0.00
 59       3   0.0   11070  92.9    0.00
 58       4   0.0   11074  92.9    0.00
 57       9   0.1   11083  93.0    0.00
 56     263   2.2   11346  95.2    0.00
 55      89   0.7   11435  95.9    0.00
 54      37   0.3   11472  96.3    0.00
 53      48   0.4   11520  96.7    0.00
 52      47   0.4   11567  97.1    0.00
 51      29   0.2   11596  97.3    0.00
 50      28   0.2   11624  97.5    0.00
 49       6   0.1   11630  97.6    0.00
 48      10   0.1   11640  97.7    0.00
 47       6   0.1   11646  97.7    0.00
 46       5   0.0   11651  97.8    0.00
 45      12   0.1   11663  97.9    0.00
 44      23   0.2   11686  98.1    0.00
 43      18   0.2   11704  98.2    0.01
 42      29   0.2   11733  98.4    0.01
 41       5   0.0   11738  98.5    0.01
 40      30   0.3   11768  98.7    0.01
 39      10   0.1   11778  98.8    0.01
 38       2   0.0   11780  98.8    0.01
 37       7   0.1   11787  98.9    0.01
 36       1   0.0   11788  98.9    0.01
 35       6   0.1   11794  99.0    0.02
 34       9   0.1   11803  99.0    0.02
 33       5   0.0   11808  99.1    0.02
 32      11   0.1   11819  99.2    0.03
 31       2   0.0   11821  99.2    0.03
 29       6   0.1   11827  99.2    0.04
 28       1   0.0   11828  99.2    0.04
 27       1   0.0   11829  99.3    0.04
 25       3   0.0   11832  99.3    0.05
 24       1   0.0   11833  99.3    0.06
 22       3   0.0   11836  99.3    0.07
 18       2   0.0   11838  99.3    0.11
 -1      80   0.7   11918 100.0   80.11   (quality -1 = terminal quality 0)

Avg. full length: 11918.0, trimmed (qual > -1): 11838.0
Avg. quality: 82.1 per base

Initial, terminal qual 0 segments:  1-80, (None)

Regions of LLR- adjusted quality < 2.0:
1-80, 1514-1515, 

3 regions, avg size 27.3, avg spacing 3972.7

First_start: 93, last_end: 11918

Slack, # used pairs (max_score), unused
 0   426  (22.0)     0 ( 0.0)     1002
 1   341  (21.7)     0 ( 0.0)       88
 2   116  (21.8)     1 ( 2.5)        4
 3    82  (21.6)     0 ( 0.0)        0
 4    46  (21.0)     0 ( 0.0)        0
 5    29  (19.3)     0 ( 0.0)        0
 6    22  (14.4)     0 ( 0.0)        0
 7    14  (21.5)     0 ( 0.0)        0
 8     8  (20.2)     0 ( 0.0)        0
 9     3  ( 6.7)     0 ( 0.0)        0
10     4  (18.0)     0 ( 0.0)        0
11     1  (20.0)     0 ( 0.0)        0
15     1  ( 0.9)     0 ( 0.0)        0

LLR histograms (used, unused pairs): 

   DS Gap         Size      Closest read (Start)   Covers   Read length required
                                                    now?        to cover
Top strand: 
 left -     0        0+
 1565 -  2443      879       ec010109r1   ( 526)    No           1918
11919 - right        0+      de030109r1   (11712)    No            206+

Bottom strand: 
 left -  1248     1248+      eb050109r1   (2308)    No           2308+
 2775 -  3111      337       ec010109f1   (4156)    No           1382 
11919 - right        0+

Read/contig alignment summary, by read base; trace qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
56  39656  39656 107181 (100.00)    12  0    0   0   0   0     0 (0.00)    0  1651 (1.54)
51  10849  50505  67525 ( 63.00)     2  0    0   0   0   0     0 (0.00)    0  1651 (2.45)
50   2812  53317  56676 ( 52.88)     2  0    0   0   0   0     0 (0.00)    0  1651 (2.91)
48    628  53945  53864 ( 50.26)    10  0    0   0   0   0     0 (0.00)    0  1651 (3.07)
47    546  54491  53236 ( 49.67)     0  0    0   0   0   0     0 (0.00)    0  1651 (3.10)
46   1499  55990  52690 ( 49.16)    16  0    0   0   0   0     0 (0.00)    0  1651 (3.13)
45   2355  58345  51191 ( 47.76)     1  0    0   0   0   0     0 (0.00)    0  1651 (3.23)
44   1928  60273  48836 ( 45.56)     2  0    0   0   0   0     0 (0.00)    0  1651 (3.38)
43   2221  62494  46908 ( 43.77)     3  0    0   0   0   0     0 (0.00)    0  1651 (3.52)
42   4010  66504  44687 ( 41.69)     5  0    0   0   0   0     0 (0.00)    0  1651 (3.69)
41    537  67041  40677 ( 37.95)     3  0    0   0   0   0     0 (0.00)    0  1651 (4.06)
40   5593  72634  40140 ( 37.45)    49  0    0   1   0   1     2 (0.04)    2  1651 (4.11)
39    347  72981  34547 ( 32.23)     4  0    0   0   0   0     0 (0.00)    2  1649 (4.77)
38    218  73199  34200 ( 31.91)     4  0    0   0   0   0     0 (0.00)    2  1649 (4.82)
37   1499  74698  33982 ( 31.71)     3  0    0   0   0   0     0 (0.00)    2  1649 (4.85)
36    202  74900  32483 ( 30.31)     0  0    0   0   0   0     0 (0.00)    2  1649 (5.08)
35   1378  76278  32281 ( 30.12)     1  0    0   0   0   0     0 (0.00)    2  1649 (5.11)
34    935  77213  30903 ( 28.83)     6  0    0   0   0   0     0 (0.00)    2  1649 (5.34)
33    722  77935  29968 ( 27.96)     3  0    0   0   1   0     1 (0.14)    3  1649 (5.50)
32   1002  78937  29246 ( 27.29)    57  0    0   0   0   0     0 (0.00)    3  1648 (5.63)
31    454  79391  28244 ( 26.35)     3  0    0   0   0   0     0 (0.00)    3  1648 (5.83)
30    274  79665  27790 ( 25.93)     5  0    0   0   0   0     0 (0.00)    3  1648 (5.93)
29   1908  81573  27516 ( 25.67)    41  0    0   0   5   0     5 (0.26)    8  1648 (5.99)
28    470  82043  25608 ( 23.89)    10  0    0   0   0   0     0 (0.00)    8  1643 (6.42)
27    684  82727  25138 ( 23.45)    34  0    0   0   0   0     0 (0.00)    8  1643 (6.54)
26    268  82995  24454 ( 22.82)    10  0    0   0   0   0     0 (0.00)    8  1643 (6.72)
25   1581  84576  24186 ( 22.57)    41  0    0   1   1   1     3 (0.19)   11  1643 (6.79)
24    805  85381  22605 ( 21.09)    43  0    0   0   0   0     0 (0.00)   11  1640 (7.26)
23    523  85904  21800 ( 20.34)    55  0    0   0   3   1     4 (0.76)   15  1640 (7.52)
22    670  86574  21277 ( 19.85)    27  0    0   0   3   1     4 (0.60)   19  1636 (7.69)
21    730  87304  20607 ( 19.23)    40  0    0   1   1   0     2 (0.27)   21  1632 (7.92)
20    623  87927  19877 ( 18.55)    77  0    0   2   2   0     4 (0.64)   25  1630 (8.20)
19   1049  88976  19254 ( 17.96)    70  0    0   2   3   1     6 (0.57)   31  1626 (8.44)
18    831  89807  18205 ( 16.99)    48  0    0   4   3   3    10 (1.20)   41  1620 (8.90)
17    706  90513  17374 ( 16.21)    44  0    0   5   5   0    10 (1.42)   51  1610 (9.27)
16    708  91221  16668 ( 15.55)    72  0    0   8   1   0     9 (1.27)   60  1600 (9.60)
15   1095  92316  15960 ( 14.89)    91  0    0   5   6   0    11 (1.00)   71  1591 (9.97)
14    809  93125  14865 ( 13.87)    74  0    0  17   5   1    23 (2.84)   94  1580 (10.63)
13   1086  94211  14056 ( 13.11)   123  0    0  20   9   2    31 (2.85)  125  1557 (11.08)
12   1187  95398  12970 ( 12.10)    77  0    0  22  16   2    40 (3.37)  165  1526 (11.77)
11   1446  96844  11783 ( 10.99)    96  0    0  57  24   6    87 (6.02)  252  1486 (12.61)
10   2020  98864  10337 (  9.64)   122  0    0 105  49   5   159 (7.87)  411  1399 (13.53)
 9   2914 101778   8317 (  7.76)   248  0    0 185  72  19   276 (9.47)  687  1240 (14.91)
 8   2326 104104   5403 (  5.04)   161  0    0 204 110   8   322 (13.84)  1009  964 (17.84)
 7   2108 106212   3077 (  2.87)   129  0    0 213 167   5   385 (18.26)  1394  642 (20.86)
 6    840 107052    969 (  0.90)   168  0    0 122  91   2   215 (25.60)  1609  257 (26.52)
 4     98 107150    129 (  0.12)    22  0    0   7   4   0    11 (11.22)  1620   42 (32.56)
 0     31 107181     31 (  0.03)     2  0   15   0  16   0    31 (100.00)  1651   31 (100.00)
-1     73 107254      0 (  0.00)  9559  0    0   3   6   0     9 (12.33)  1660    0 (0.00)


Read/contig alignment summary, by read base; adjusted qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
90  81435  81435 104121 (100.00)     0  0    0   0   0   0     0 (0.00)    0  1004 (0.96)
89     39  81474  22686 ( 21.79)     0  0    0   0   0   0     0 (0.00)    0  1004 (4.43)
88     82  81556  22647 ( 21.75)     0  0    0   0   0   0     0 (0.00)    0  1004 (4.43)
87     82  81638  22565 ( 21.67)     0  0    0   0   0   0     0 (0.00)    0  1004 (4.45)
86     58  81696  22483 ( 21.59)     0  0    0   0   0   0     0 (0.00)    0  1004 (4.47)
85     71  81767  22425 ( 21.54)     0  0    0   0   0   0     0 (0.00)    0  1004 (4.48)
84     49  81816  22354 ( 21.47)     0  0    0   0   0   0     0 (0.00)    0  1004 (4.49)
83     31  81847  22305 ( 21.42)     0  0    0   0   0   0     0 (0.00)    0  1004 (4.50)
82     32  81879  22274 ( 21.39)     0  0    0   0   0   0     0 (0.00)    0  1004 (4.51)
81   1093  82972  22242 ( 21.36)     0  0    0   0   0   0     0 (0.00)    0  1004 (4.51)
80     10  82982  21149 ( 20.31)     0  0    0   0   0   0     0 (0.00)    0  1004 (4.75)
79     32  83014  21139 ( 20.30)     0  0    0   0   0   0     0 (0.00)    0  1004 (4.75)
78     52  83066  21107 ( 20.27)     0  0    0   0   0   0     0 (0.00)    0  1004 (4.76)
77     31  83097  21055 ( 20.22)     0  0    0   0   0   0     0 (0.00)    0  1004 (4.77)
76    229  83326  21024 ( 20.19)     0  0    0   0   0   0     0 (0.00)    0  1004 (4.78)
75     84  83410  20795 ( 19.97)     0  0    0   0   0   0     0 (0.00)    0  1004 (4.83)
74     33  83443  20711 ( 19.89)     0  0    0   0   0   0     0 (0.00)    0  1004 (4.85)
73     98  83541  20678 ( 19.86)     0  0    0   0   0   0     0 (0.00)    0  1004 (4.86)
72     18  83559  20580 ( 19.77)     0  0    0   0   0   0     0 (0.00)    0  1004 (4.88)
71     49  83608  20562 ( 19.75)     0  0    0   0   0   0     0 (0.00)    0  1004 (4.88)
70     39  83647  20513 ( 19.70)     0  0    0   0   0   0     0 (0.00)    0  1004 (4.89)
69     53  83700  20474 ( 19.66)     0  0    0   0   0   0     0 (0.00)    0  1004 (4.90)
68     17  83717  20421 ( 19.61)     0  0    0   0   0   0     0 (0.00)    0  1004 (4.92)
67     52  83769  20404 ( 19.60)     0  0    0   0   0   0     0 (0.00)    0  1004 (4.92)
66   7073  90842  20352 ( 19.55)     0  0    0   0   0   0     0 (0.00)    0  1004 (4.93)
65    209  91051  13279 ( 12.75)     0  0    0   0   0   0     0 (0.00)    0  1004 (7.56)
64     36  91087  13070 ( 12.55)     0  0    0   0   0   0     0 (0.00)    0  1004 (7.68)
63      7  91094  13034 ( 12.52)     0  0    0   0   0   0     0 (0.00)    0  1004 (7.70)
62     47  91141  13027 ( 12.51)     0  0    0   0   0   0     0 (0.00)    0  1004 (7.71)
61   1636  92777  12980 ( 12.47)     0  0    0   0   0   0     0 (0.00)    0  1004 (7.73)
60    227  93004  11344 ( 10.90)     0  0    0   0   0   0     0 (0.00)    0  1004 (8.85)
59     77  93081  11117 ( 10.68)     0  0    0   0   0   0     0 (0.00)    0  1004 (9.03)
58     57  93138  11040 ( 10.60)     0  0    0   0   0   0     0 (0.00)    0  1004 (9.09)
57    128  93266  10983 ( 10.55)     0  0    0   0   0   0     0 (0.00)    0  1004 (9.14)
56    472  93738  10855 ( 10.43)     0  0    0   0   0   0     0 (0.00)    0  1004 (9.25)
55    383  94121  10383 (  9.97)     0  0    0   0   0   0     0 (0.00)    0  1004 (9.67)
54    201  94322  10000 (  9.60)     0  0    0   0   0   0     0 (0.00)    0  1004 (10.04)
53    151  94473   9799 (  9.41)     0  0    0   0   0   0     0 (0.00)    0  1004 (10.25)
52    190  94663   9648 (  9.27)     0  0    0   0   0   0     0 (0.00)    0  1004 (10.41)
51     90  94753   9458 (  9.08)     0  0    0   0   0   0     0 (0.00)    0  1004 (10.62)
50    156  94909   9368 (  9.00)     0  0    0   0   0   0     0 (0.00)    0  1004 (10.72)
49    100  95009   9212 (  8.85)     0  0    0   0   0   0     0 (0.00)    0  1004 (10.90)
48    101  95110   9112 (  8.75)     0  0    0   0   0   0     0 (0.00)    0  1004 (11.02)
47     44  95154   9011 (  8.65)     0  0    0   0   0   0     0 (0.00)    0  1004 (11.14)
46    118  95272   8967 (  8.61)     0  0    0   0   0   0     0 (0.00)    0  1004 (11.20)
45    106  95378   8849 (  8.50)     0  0    0   0   0   0     0 (0.00)    0  1004 (11.35)
44    131  95509   8743 (  8.40)     0  0    0   0   0   0     0 (0.00)    0  1004 (11.48)
43    117  95626   8612 (  8.27)     0  0    0   0   0   0     0 (0.00)    0  1004 (11.66)
42    140  95766   8495 (  8.16)     0  0    0   0   0   0     0 (0.00)    0  1004 (11.82)
41    113  95879   8355 (  8.02)     0  0    0   0   1   0     1 (0.88)    1  1004 (12.02)
40   1954  97833   8242 (  7.92)     0  0    0   1   0   1     2 (0.10)    3  1003 (12.17)
39     51  97884   6288 (  6.04)     0  0    0   0   0   0     0 (0.00)    3  1001 (15.92)
38     27  97911   6237 (  5.99)     0  0    0   0   1   0     1 (3.70)    4  1001 (16.05)
37     52  97963   6210 (  5.96)     0  0    0   0   0   0     0 (0.00)    4  1000 (16.10)
36     36  97999   6158 (  5.91)     0  0    0   0   0   0     0 (0.00)    4  1000 (16.24)
35     67  98066   6122 (  5.88)     0  0    0   0   0   0     0 (0.00)    4  1000 (16.33)
34     99  98165   6055 (  5.82)     0  0    0   0   0   0     0 (0.00)    4  1000 (16.52)
33     66  98231   5956 (  5.72)     1  0    0   0   0   0     0 (0.00)    4  1000 (16.79)
32     76  98307   5890 (  5.66)     0  0    0   0   0   0     0 (0.00)    4  1000 (16.98)
31     34  98341   5814 (  5.58)     0  0    0   0   0   0     0 (0.00)    4  1000 (17.20)
30     27  98368   5780 (  5.55)     0  0    0   0   0   0     0 (0.00)    4  1000 (17.30)
29     84  98452   5753 (  5.53)     1  0    0   0   5   0     5 (5.95)    9  1000 (17.38)
28     44  98496   5669 (  5.44)     3  0    0   9   0   0     9 (20.45)   18  995 (17.55)
27     51  98547   5625 (  5.40)     1  0    0   0   1   0     1 (1.96)   19  986 (17.53)
26     25  98572   5574 (  5.35)     0  0    0   0   0   0     0 (0.00)   19  985 (17.67)
25    237  98809   5549 (  5.33)     2  0    0   1   2   1     4 (1.69)   23  985 (17.75)
24     67  98876   5312 (  5.10)     3  0    0   0   0   0     0 (0.00)   23  981 (18.47)
23     72  98948   5245 (  5.04)     2  0    0   0   5   1     6 (8.33)   29  981 (18.70)
22     59  99007   5173 (  4.97)     7  0    0   0   3   1     4 (6.78)   33  975 (18.85)
21     63  99070   5114 (  4.91)     7  0    0   0   1   0     1 (1.59)   34  971 (18.99)
20     60  99130   5051 (  4.85)    14  0    0   1   2   0     3 (5.00)   37  970 (19.20)
19    124  99254   4991 (  4.79)    11  0    0   0   3   1     4 (3.23)   41  967 (19.37)
18     94  99348   4867 (  4.67)    15  0    0   2   3   3     8 (8.51)   49  963 (19.79)
17    109  99457   4773 (  4.58)     9  0    0   3   5   0     8 (7.34)   57  955 (20.01)
16    109  99566   4664 (  4.48)    21  0    0   3   0   0     3 (2.75)   60  947 (20.30)
15    158  99724   4555 (  4.37)     7  0    0   8   6   0    14 (8.86)   74  944 (20.72)
14    133  99857   4397 (  4.22)    21  0    0   5   2   1     8 (6.02)   82  930 (21.15)
13    224 100081   4264 (  4.10)    40  0    0   9   5   2    16 (7.14)   98  922 (21.62)
12    240 100321   4040 (  3.88)    25  0    0   6  11   1    18 (7.50)  116  906 (22.43)
11    321 100642   3800 (  3.65)    41  0    0  23  16   4    43 (13.40)  159  888 (23.37)
10    520 101162   3479 (  3.34)    38  0    0  44  34   3    81 (15.58)  240  845 (24.29)
 9    844 102006   2959 (  2.84)   106  0    0  76  39  15   130 (15.40)  370  764 (25.82)
 8    736 102742   2115 (  2.03)    38  0    0 122  77   4   203 (27.58)  573  634 (29.98)
 7    875 103617   1379 (  1.32)    25  0    0 148 108   4   260 (29.71)  833  431 (31.25)
 6    397 104014    504 (  0.48)    34  0    0  76  59   1   136 (34.26)  969  171 (33.93)
 4     82 104096    107 (  0.10)    10  0    0   7   3   0    10 (12.20)  979   35 (32.71)
 0     25 104121     25 (  0.02)     0  0   10   0  15   0    25 (100.00)  1004   25 (100.00)
-1   3133 107254      0 (  0.00)  11193  0    5 440 196  15   656 (20.94)  1660    0 (0.00)


Depth 0 regions:

Block histogram:
Qual   bases    cum    blocks
  0      80       80        1
 18       2       82        2
 22       3       85        3
 24       1       86        3
 25       3       89        3
 27       1       90        3
 28       1       91        4
 29       6       97        8
 31       2       99        9
 32      11      110       10
 33       5      115       13
 34       9      124       16
 35       6      130       16
 36       1      131       17
 37       7      138       20
 38       2      140       21
 39      10      150       23
 40      30      180       29
 41       5      185       30
 42      29      214       34
 43      18      232       35
 44      23      255       36
 45      12      267       35
 46       5      272       33
 47       6      278       33
 48      10      288       30
 49       6      294       29
 50      28      322       31
 51      29      351       41
 52      47      398       46
 53      48      446       60
 54      37      483       73
 55      89      572       88
 56     263      835       79
 57       9      844       76
 58       4      848       75
 59       3      851       76
 60      76      927       75
 61     372     1299      115
 62       2     1301      116
 64       4     1305      116
 65       9     1314      118
 66    1593     2907       19
 68       7     2914       20
 69       6     2920       21
 70       6     2926       23
 71      11     2937       23
 72       7     2944       24
 73      15     2959       30
 74      19     2978       33
 75      41     3019       34
 76      32     3051       41
 77      13     3064       41
 78      12     3076       38
 79      13     3089       36
 80       8     3097       36
 81     187     3284       32
 82      11     3295       30
 83       8     3303       28
 84      11     3314       25
 85      10     3324       22
 86       6     3330       21
 87      12     3342       22
 88      12     3354       27
 89       6     3360       27
 90    8558    11918        1

SS region: 2464 (20.67%), flagged: 0 (0.00%)

Sites with total LLR scores < -3.0  [max pos LLR read, max neg LLR read]  (#discrep top reads, #discrep bottom reads):
  411     -4.0  [-4.0,  0.0]  (1, 0)
 2264     -4.0  [-4.0,  0.0]  (0, 1)
 2654     -4.0  [-4.0,  0.0]  (0, 1)
 5360     -4.0  [-4.0,  0.0]  (0, 1)
 7162     -4.6  [-4.6,  0.0]  (0, 1)
 7248     -3.3  [-3.3,  0.0]  (1, 0)
 7883     -5.6  [-5.6,  0.0]  (0, 1)
 8053     -4.0  [-4.0,  0.0]  (0, 1)
 8419     -4.6  [-4.6,  0.0]  (0, 1)
 8722     -7.4  [-4.0,  0.0]  (0, 2)
 8996     -3.0  [-3.0,  0.0]  (0, 1)
10316     -3.3  [-3.3,  0.0]  (0, 1)
11331     -4.0  [-4.0,  0.0]  (1, 0)
11454     -4.2  [-4.2,  0.0]  (0, 1)
11521     -5.0  [-2.9,  0.0]  (0, 2)
11795     -4.6  [-4.6,  0.0]  (0, 1)
11830     -4.0  [-4.0,  0.0]  (0, 1)

Read/contig discrepancies (* = higher-quality): None.
0 lower quality discrepant sites.

Reads with neg LLR score, or confirmed or high-qual unaligned seg > 20 bases, or other problem:

(Lngths init HQ, CF unalgn segs); aligned contig pos [LLR score]; (terminal HQ, CF unalgn); read id; aligned read pos
| confirmed read segments | unaligned read segments matching elsewhere
 (LU = local unaligned, DU = distant unaligned, DA = distant aligned, ** = overlaps trimmed region
 || Best local and distant LLR scores
(0, 0) 11763-11918 [ 3.4] (142,0)     de030109r1         52-207 || local(+/-) (3.4,0.0), distant (0.0,0.0)

Gaps in unique-read coverage:   I 1550- 1943

Contig 19.  666 reads; 44080 bp (untrimmed), 44080 (trimmed).
C -1076   176 cb010109f1    139 (  0)  0.66 0.66 0.00 1077 (1077)   24 ( 15) 
C  -964    75 ce040109f1     46 (  0)  2.04 0.00 0.00  965 (965)   26 ( 28) 
C  -954    93 be010109f1     61 (  0)  2.94 0.00 0.00  955 (955)   25 ( 25) 
C  -889   175 bc010109f1    135 (  0)  2.63 0.00 0.00  890 (890)   23 ( 14) 
C  -857   181 ba100109f1    141 (  0)  0.00 1.29 0.00  858 (858)   26 ( 26) 
C  -847   193 ea070109f1    160 (  0)  0.00 0.00 0.00  848 (848)   26 ( 26) 
C  -468   640 bh050109f1    362 (  0)  11.35 0.50 0.17  473 (473)   37 ( 37) 
   -266   774 db020109f1    665 ( 36)  0.67 1.47 0.00  267 (267)   26 ( 25) 
C  -163   944 bc050109f1    104 (  0)  3.57 1.43 0.71  944 (944)   24 ( 24) 
    -68   981 de120109r1     70 ( 32)  25.33 2.40 0.00  106 (1068)  194 (1067) 
    -71   996 db020109r1     40 (  0)  23.26 3.48 0.65  374 (111)  234 (928) 
    -70   982 dg030109r1    533 (  0)  9.68 0.84 0.24  212 (559)    4 (  4) 
    -60  1024 bf110109r1    141 (  0)  17.27 0.00 0.30  364 (484)  391 (421) 
    -48   897 c03hba0166b15_t703  604 (  0)  4.59 3.36 0.22   49 ( 81)    3 (  3) 
    -59  1006 ba040109r1    620 (  0)  0.72 1.16 0.00  347 (347)   28 ( 77) 
    -52   891 c03hba0166b15_t702  686 ( 32)  3.39 1.92 0.34   55 ( 57)    3 ( 18) 
    -50   921 c03hba0166b15_t701  561 (  0)  3.31 2.67 1.02   55 ( 55)  131 (103) 
    -50   986 ce040109r1     32 (  0)  2.78 0.00 0.00   63 ( 67)  938 (939) 
     25  1044 ce120109f1    970 (  0)  0.00 0.00 0.00   22 ( 22)    0 (  0) 
     32  1063 cb070109f1    958 (  0)  0.40 0.30 0.00   21 ( 21)    0 (  0) 
    198  1275 bc100109r1    298 (  0)  11.06 0.87 0.43   46 (137)  571 (631) 
    253  1328 be050109f1    837 (  0)  2.72 1.55 0.19   24 ( 24)   23 ( 66) 
C   439  1517 ad030109r1    539 (  0)  0.51 0.00 0.00  446 (446)   48 ( 48) 
C   485  1514 ca070109r1      4 (  0)  0.00 0.00 0.00  393 (1029)  632 (1030) 
    588  1665 bc060109r1    887 (  0)  1.08 0.79 0.00   49 ( 49)   14 ( 47) 
    609  1670 db050109r1    940 (  0)  0.20 0.20 0.00   44 ( 44)    0 (  0) 
    633  1648 da100109r1    908 (  0)  0.00 0.00 0.00   47 ( 47)    0 (  0) 
    731  1833 bc050109r1    115 (  0)  2.14 1.43 0.00   50 ( 50)  913 (913) 
    748  1788 bg020109f1    863 (  0)  0.80 1.01 0.00   25 ( 25)   21 ( 75) 
    864  1924 ad030109f1    540 (  0)  0.34 0.00 0.00   23 ( 23)  455 (455) 
C   880  1939 ce050109f1     32 (  0)  0.00 0.00 0.00  998 (998)   26 ( 11) 
    894  1953 ee090109f1    936 (  0)  0.19 0.19 0.10   21 ( 21)    5 (  0) 
    947  1969 bh020109r1    806 (  0)  1.46 0.52 0.31   49 ( 49)   14 ( 21) 
C  1186  2229 bg020109r1    783 (  0)  1.41 1.71 0.00    2 ( 50)   47 ( 47) 
C  1228  2516 ec020109f1     81 (  0)  16.49 0.00 0.00 1064 (1166)   31 ( 27) 
C  1340  2400 cc080109r1     54 ( 36)  12.29 6.15 0.56   30 (120)  852 (909) 
C  1365  2385 ce120109r1    855 (  0)  0.10 0.31 0.10    0 (  0)   46 ( 46) 
C  1638  2708 ba040109f1    760 (  0)  1.03 1.44 0.10   70 (121)   27 ( 27) 
C  1677  2711 bh020109f1    684 (  0)  1.60 2.25 0.11   76 (160)   24 ( 24) 
   1660  2679 da080109f1    857 (  0)  0.30 0.10 0.10   20 ( 20)    0 (  0) 
C  1693  2718 dg030109f1    875 (  0)  0.00 0.00 0.00    0 (  0)   23 ( 23) 
C  1790  2794 da100109f1    838 (  0)  0.31 0.10 0.10    0 (  0)   23 ( 25) 
   1831  2890 ce050109r1     29 (  0)  0.00 0.00 0.00   50 ( 50)  977 (963) 
C  1864  2907 cb070109r1    849 (  0)  0.20 0.10 0.10    0 (  0)   48 ( 48) 
C  1933  2985 bc100109f1    807 (  0)  1.85 0.19 0.19    2 ( 38)   23 ( 23) 
C  2325  3389 ee090109r1    841 (  0)  0.39 0.29 0.00    0 ( 16)   46 ( 46) 
   2576  3608 da030109f1    842 (  0)  0.70 0.20 0.10   24 ( 24)    7 ( 23) 
C  2853  3945 bc060109f1    882 (  0)  0.30 0.10 0.00   77 ( 77)   25 ( 25) 
   2932  4031 bd030109r1    631 (  0)  2.71 2.12 0.12   50 ( 92)  202 (285) 
C  3010  4132 be050109r1    763 (  0)  1.34 0.67 0.00  174 (221)   53 ( 53) 
   3150  4179 db080109f1    890 (  0)  0.60 0.30 0.00   26 ( 26)    0 (  8) 
C  3529  4583 db050109f1    967 (  0)  0.29 0.00 0.10    0 (  0)   23 ( 23) 
C  3586  4615 da080109r1    927 (  0)  0.10 0.00 0.00    0 (  0)   48 ( 48) 
   3626  4719 be070109f1    919 (  0)  0.39 0.98 0.00   25 ( 25)   52 ( 87) 
   3676  4752 cd060109f1    978 (  0)  0.28 0.57 0.09   22 ( 22)    0 (  0) 
C  4000  5046 da030109r1    960 (  0)  0.20 0.30 0.00    0 (  0)   44 ( 44) 
   4298  5387 bc080109f1    877 (  0)  1.03 0.93 0.10   24 ( 24)   99 ( 99) 
   4485  5551 cg100109f1    953 (  0)  0.40 0.40 0.00   44 ( 44)   16 ( 16) 
C  4500  5535 db080109r1    889 (  0)  1.01 1.11 0.10    2 (  2)   43 ( 43) 
   4663  5692 ag010109r1    850 (  0)  0.55 0.55 0.00   51 ( 51)   65 ( 69) 
   4702  5807 ah030109f1    593 (  0)  5.21 1.27 0.13  125 (125)  194 (257) 
C  4987  6084 be070109r1    866 (  0)  1.13 1.23 0.00   69 (109)   52 ( 52) 
C  5365  6513 bd030109f1    573 (  0)  3.71 0.86 0.14  422 (483)   26 ( 26) 
C  5449  6535 ae090109r1    246 (  0)  1.86 0.00 0.00  771 (762)   47 ( 47) 
C  5471  6552 cd060109r1    986 (  0)  0.19 0.19 0.00    0 (  0)   49 ( 49) 
C  5539  6601 eh090109f1     38 (  0)  0.00 0.00 0.00 1000 (1000)   23 ( 15) 
C  5610  6707 eh100109r1     32 (  0)  0.00 0.00 0.00 1020 (1014)   46 ( 46) 
   5712  7084 ah110109f1      8 ( 31)  0.00 0.00 0.00  657 (1373)  708 (1372) 
   5693  6821 ac020109f1    122 ( 50)  22.32 1.81 0.54  272 (324)  306 (615) 
C  5844  6867 ag010109f1    911 (  0)  0.81 0.81 0.10    4 ( 14)   30 ( 30) 
   5877  6939 af110109r1    783 (  0)  2.21 1.32 0.00   49 ( 49)  107 (107) 
   5946  6952 dc110109f1    953 (  0)  0.20 0.31 0.00   24 ( 24)    0 (  0) 
C  6004  7035 ca010109f1    690 (  0)  0.00 0.14 0.00  309 (309)   23 (  8) 
   6168  7266 ca020109r1    294 (  0)  8.11 0.72 0.00   46 ( 46)  634 (768) 
   6196  7348 ae090109f1    252 (  0)  0.75 0.00 0.00   27 ( 16)  860 (860) 
   6269  7311 ca010109r1    687 (  0)  0.14 0.00 0.00   44 ( 44)  303 (283) 
   6280  7353 ed060109r1    973 (  0)  0.39 0.20 0.00   47 ( 47)   12 ( 12) 
   6443  7467 cg070109r1    919 (  0)  0.61 0.51 0.10   44 ( 44)    0 (  0) 
   6494  7542 eh090109r1     39 (  0)  0.00 0.00 0.00   45 ( 45)  963 (956) 
C  6560  7612 cg100109r1    939 (  0)  0.90 0.10 0.20    8 ( 38)   46 ( 46) 
   6567  7638 ab090109r1    838 (  0)  2.19 1.15 0.00   45 ( 45)   67 ( 99) 
   6606  7702 eh100109f1     32 (  0)  0.00 0.00 0.00   25 ( 17) 1040 (1040) 
C  6930  8001 ac020109r1    396 (  0)  13.95 2.21 0.35   32 (218)  180 (450) 
C  6993  8086 bc080109r1    805 (  0)  2.77 0.85 0.11  101 (150)   53 ( 53) 
   7132  8180 eg100109r1    975 (  0)  0.10 0.20 0.00   46 ( 46)    1 (  1) 
C  7220  8264 df090109r1    880 (  0)  0.00 0.11 0.00  102 ( 93)   48 ( 48) 
   7290  8365 be100109f1    909 ( 38)  0.62 0.82 0.00   30 ( 27)   73 (126) 
   7297  8332 df090109f1    874 (  0)  0.11 0.22 0.00   25 ( 15)  116 (116) 
   7433  8447 ea100109f1    947 (  0)  0.51 0.10 0.00   37 ( 40)    0 (  0) 
   7457  8496 dc100109r1    959 (  0)  0.20 0.10 0.00   48 ( 48)    3 (  3) 
   7542  8588 db070109f1    996 (  0)  0.10 0.10 0.00   22 ( 22)    0 (  0) 
C  7568  8598 cg070109f1    952 (  0)  0.70 0.10 0.10    0 (  5)   28 ( 28) 
C  7580  8592 dc110109r1    942 (  0)  0.21 0.00 0.00    0 (  0)   44 ( 44) 
   7698  8739 df020109f1    972 (  0)  0.19 0.49 0.10   15 ( 22)    0 (  0) 
   7726  8733 dd110109f1    952 (  0)  0.00 0.20 0.00   24 ( 24)    0 (  0) 
   7832  8873 ef090109r1    930 (  0)  0.20 0.81 0.00   52 ( 52)    0 (  0) 
   7944  9020 be060109f1    955 (119)  0.78 0.58 0.00   27 ( 29)   24 ( 43) 
C  7953  9140 ab090109f1    554 (155)  3.56 1.71 0.14  461 (561)   25 ( 29) 
   8020  9038 dd120109f1    956 (152)  0.10 0.20 0.00   25 ( 25)    3 (  3) 
C  8026  9157 ca020109f1    264 (149)  5.42 0.30 0.00  698 (758)  102 (102) 
C  8029  9101 ae110109r1    328 (152)  1.13 0.00 0.00  668 (668)   52 ( 52) 
C  8084  9180 af110109f1    682 (318)  2.10 1.61 0.00  174 (232)  114 (133) 
C  8170  9217 df020109r1    944 (455)  0.10 0.40 0.00    5 ( 10)   47 ( 46) 
C  8433  9523 ed060109f1    922 (161)  2.01 0.86 0.00    5 ( 77)   40 ( 40) 
   8443  9527 ac050109f1    971 (184)  0.94 0.76 0.00   26 ( 26)    0 ( 25) 
   8472  9503 eb100109f1    966 (170)  0.20 0.20 0.00   28 ( 28)    0 (  0) 
   8500  9517 dh090109f1    956 (153)  0.20 0.30 0.00   22 ( 22)    0 (  0) 
C  8531  9536 ea100109r1    926 (152)  0.10 0.31 0.00    0 (  0)   43 ( 43) 
   8670  9740 ae110109f1    278 (152)  1.01 0.00 0.00   83 ( 88)  691 (691) 
C  8783  9832 eg100109f1    981 (144)  0.39 0.00 0.10    0 (  0)   21 ( 21) 
   8829  9842 dg110109f1    933 (107)  0.20 0.61 0.00   26 ( 36)    0 (  0) 
   8881  9938 ag120109f1    782 ( 33)  0.58 0.93 0.12  113 (113)   86 (102) 
C  8957 10040 be060109r1    845 (  0)  2.38 0.41 0.10   67 (152)   50 ( 50) 
C  8971 10051 bd020109f1    736 ( 51)  1.65 1.30 0.00  117 (201)  116 (116) 
   8976 10016 ee060109f1    950 (  0)  0.59 0.39 0.10   22 ( 22)    0 (  9) 
   9008 10192 ae050109r1    562 (  0)  5.67 2.02 0.13   51 ( 51)  340 (414) 
C  9049 10119 be100109r1    876 (  0)  0.63 0.53 0.21   69 ( 82)   50 ( 50) 
   9217 10294 ac030109f1    939 (  0)  1.17 0.58 0.10   25 ( 25)   23 ( 23) 
   9651 10763 bb040109r1    913 (  0)  0.91 0.30 0.00   49 ( 49)   73 ( 99) 
C  9655 10865 be040109f1    134 (  0)  15.51 0.95 0.00  713 (793)  182 (182) 
C 10014 11125 ae050109f1    128 (  0)  18.94 0.61 0.30  272 (879)  180 (185) 
C 10093 11101 dd110109r1    917 (  0)  0.21 0.10 0.10    0 (  0)   44 ( 44) 
C 10115 11127 dg110109r1    905 (  0)  0.72 0.21 0.00    1 (  1)   45 ( 45) 
  10114 11137 da110109f1    949 (  0)  0.00 0.20 0.00   22 ( 22)    7 (  7) 
C 10135 11213 ac050109r1    940 (  0)  0.78 0.49 0.00    8 ( 63)   47 ( 47) 
  10198 11232 af120109f1    884 (  0)  1.11 0.60 0.20   30 ( 30)   11 ( 11) 
  10324 11395 bc090109r1    897 (  0)  0.81 0.61 0.00   51 ( 49)   38 ( 75) 
  10324 11364 bd120109r1    265 (  0)  1.64 0.33 0.00   51 ( 49)  686 (686) 
C 10516 11539 eb100109r1    948 (  0)  0.10 0.10 0.00    3 (  3)   45 ( 45) 
  10567 11582 ch110109r1    938 (  0)  0.31 0.00 0.00   47 ( 47)    3 (  3) 
C 10630 11654 af120109r1    881 (  0)  1.85 0.41 0.10    1 ( 49)   49 ( 18) 
C 10637 11654 dd120109r1    942 (  0)  0.31 0.10 0.00    0 (  7)   44 ( 14) 
C 10656 11757 ec040109f1    134 (  0)  1.89 1.26 0.00  915 (915)   28 ( 28) 
C 10782 11827 ee060109r1    866 (  0)  1.27 0.63 0.00   56 ( 76)   45 ( 45) 
  10836 12263 ah040109f1    182 ( 43)  14.55 2.54 0.23  136 (205)  859 (994) 
  10811 12266 ah060109f1      5 ( 46)  0.00 0.00 0.00  389 (1456) 1059 (1455) 
  10849 11901 aa020109f1    882 (  0)  1.83 0.71 0.00   26 ( 26)   41 (143) 
  11248 12339 bd050109r1    848 (  0)  1.08 0.33 0.00   48 ( 48)  122 (147) 
C 11261 12278 da110109r1    940 (  0)  0.00 0.00 0.00    0 (  0)   45 ( 45) 
C 11316 12348 ag120109r1    794 (  0)  1.29 1.39 0.11   54 (129)   47 ( 47) 
C 11357 12471 bb040109f1    863 (  0)  1.01 0.71 0.00  102 (142)   26 ( 26) 
C 11562 12628 ac030109r1    901 (  0)  0.40 0.50 0.00   14 ( 12)   44 ( 44) 
C 11613 12659 db070109r1    892 (  0)  0.20 0.60 0.00    0 (  0)   47 ( 47) 
C 11637 12716 af100109f1    151 (  0)  0.00 0.59 0.00  881 (881)   30 ( 19) 
  11729 12801 ag040109r1    856 (  0)  1.62 0.30 0.10   46 ( 46)   40 ( 60) 
  12062 13154 ae060109f1    867 (  0)  0.50 1.29 0.00   26 ( 26)   57 ( 57) 
  12081 13113 da090109f1    925 (  0)  0.00 0.10 0.00   26 ( 26)    0 (  0) 
  12094 13129 ea080109f1    930 (  0)  0.10 0.00 0.00   28 ( 28)    0 (  0) 
C 12140 13232 bd050109f1    778 (  0)  1.12 2.54 0.00   84 (200)   25 ( 25) 
  12190 13222 cf110109f1    904 (  0)  0.00 0.50 0.10   21 ( 25)    6 (  6) 
C 12358 13422 bc090109f1    882 (  0)  0.96 1.15 0.00    2 ( 13)   21 ( 21) 
  12414 13431 cg120109f1    902 (  0)  0.00 0.20 0.00   24 ( 24)    0 (  0) 
  12426 13482 bh090109f1    861 (  0)  0.68 1.27 0.00   27 ( 27)    7 ( 26) 
  12469 13541 af100109r1    138 (  0)  4.65 0.00 0.00   49 ( 49)  852 (845) 
C 12811 13860 aa020109r1    818 (  0)  1.30 0.50 0.00    0 ( 21)   50 ( 50) 
  13204 14235 dd010109f1    874 (  0)  1.29 0.30 0.00   26 ( 26)    0 (  0) 
C 13224 14254 cf110109r1    897 (  0)  0.20 0.10 0.00    0 (  0)   44 ( 44) 
C 13347 14426 ae060109r1    879 (  0)  0.80 1.00 0.00   33 ( 55)   45 ( 45) 
  13345 14397 ea050109r1    942 (  0)  0.10 0.10 0.00   45 ( 45)    0 (  0) 
  13381 14462 ad050109r1    898 (  0)  0.70 0.70 0.00   53 ( 53)   27 ( 36) 
C 13436 14462 ea080109r1    910 (  0)  0.10 0.21 0.00    4 (  0)   49 ( 49) 
C 13465 14545 ag040109f1    856 (  0)  0.41 1.54 0.10   85 (112)   22 ( 22) 
  13646 14726 ag060109f1    900 (  0)  1.07 1.26 0.00   25 ( 25)   28 ( 69) 
  13730 14767 be120109f1    855 (  0)  0.94 1.04 0.00   24 ( 24)   56 ( 89) 
C 13818 14826 ch110109f1    947 (  0)  0.00 0.00 0.10    0 (  0)   23 ( 23) 
  13824 14854 ca090109r1    950 (  0)  0.00 0.10 0.00   45 ( 45)    0 (  0) 
C 14155 15170 cg120109r1    932 (  0)  0.21 0.31 0.00    0 (  0)   45 ( 45) 
  14180 15218 ed090109f1    990 (  0)  0.00 0.00 0.10   22 ( 22)    0 (  0) 
C 14205 15263 bh090109r1    881 (  0)  0.94 0.63 0.10   57 ( 70)   46 ( 46) 
C 14332 15352 ca090109f1    976 (  0)  0.00 0.00 0.10    0 (  0)   20 ( 20) 
C 14463 15489 dd010109r1    964 (  0)  0.00 0.00 0.00    0 (  0)   44 ( 44) 
  14515 15576 eb040109f1   1008 (  0)  0.00 0.19 0.00   24 ( 24)    0 (  0) 
  14631 15684 ag100109r1    894 (  0)  1.20 1.30 0.00   48 ( 48)    3 ( 34) 
  14736 15779 de100109f1    990 (  0)  0.00 0.00 0.20   22 ( 22)    0 (  0) 
  14842 15917 bb060109f1    949 (  0)  1.16 0.29 0.10   25 ( 25)   19 ( 71) 
C 14852 15878 da090109r1    959 (  0)  0.00 0.00 0.00    0 (  0)   44 ( 44) 
C 15027 16094 ag060109r1    885 (  0)  1.30 0.50 0.40   18 ( 59)   48 ( 48) 
  15033 16053 eg120109r1    915 (  0)  0.10 0.41 0.00   46 ( 46)    2 (  2) 
C 15141 16187 ea050109f1    982 (  0)  0.10 0.00 0.00    0 (  0)   21 ( 21) 
  15241 16272 dc090109f1    933 (  0)  0.70 0.30 0.00   24 ( 24)    1 ( 17) 
  15455 16521 bb020109f1    756 (  0)  1.98 2.92 0.00   28 ( 28)   79 (206) 
C 15483 16555 ad050109f1    933 (  0)  0.48 0.77 0.19    7 (  7)   27 ( 27) 
  15567 16588 ch070109f1    909 (  0)  0.41 0.10 0.20   24 ( 24)   13 ( 13) 
C 15587 16621 be120109r1    834 (  0)  0.11 0.87 0.00   69 ( 69)   49 ( 49) 
C 15617 16660 ag100109f1    848 (  0)  1.66 0.31 0.10    3 ( 45)   79 ( 79) 
  15707 16750 de040109f1    931 (  0)  1.18 0.10 0.00   22 ( 22)    4 ( 20) 
  15717 16745 ch050109f1    954 (  0)  0.10 0.10 0.00   22 ( 21)    0 (  0) 
C 15812 16847 de100109r1    951 (  0)  0.00 0.00 0.00    0 (  0)   47 ( 47) 
C 15853 16865 ch070109r1    911 (  0)  0.41 0.31 0.00    0 (  0)   45 ( 45) 
  15936 16987 ce030109r1    938 (  0)  1.10 0.20 0.00   50 ( 50)    0 (  0) 
C 15941 16963 ed090109r1    953 (  0)  0.10 0.00 0.00    0 (  0)   42 ( 42) 
C 16044 17059 ch050109r1    818 (  0)  0.00 0.35 0.00    0 (  0)  162 (162) 
  16107 17133 dg020109r1    929 (  0)  0.10 0.41 0.00   46 (  2)    0 (  0) 
  16109 17141 cg030109r1    936 (  0)  0.20 0.30 0.00   44 (  0)    1 (  1) 
C 16188 17270 bb060109r1    850 (  0)  0.74 0.74 0.11   90 ( 90)   50 ( 50) 
  16234 17270 ae010109r1    883 (  0)  1.03 0.41 0.00   47 ( 47)   19 ( 19) 
C 16264 17383 bc020109r1    434 (  0)  0.60 0.00 0.00  568 (552)   56 ( 56) 
  16267 17326 bg090109f1    855 (  0)  0.58 2.63 0.00   30 ( 30)    2 (139) 
  16429 17526 ad080109f1    852 (  0)  1.21 1.21 0.00   24 ( 24)   84 ( 99) 
  16439 17475 cd070109f1    940 (  0)  0.10 0.20 0.20   20 ( 20)    0 (  0) 
C 16480 17478 eh010109r1    311 (  0)  0.00 0.00 0.00  587 (578)   43 ( 43) 
  16602 17632 cf050109r1    904 (  0)  0.00 0.10 0.00   47 ( 47)    5 (  0) 
  16807 17917 bc020109f1    428 (  0)  0.40 0.40 0.00   25 (  9)  590 (590) 
C 16840 17897 eb040109r1    878 (  0)  0.40 0.69 0.00    0 (  0)   48 ( 48) 
C 16869 17903 dc090109r1    876 (  0)  0.30 0.30 0.00    0 (  0)   45 ( 45) 
C 16869 17894 ae010109f1    852 (  0)  0.99 0.10 0.60    0 (  0)   20 ( 20) 
C 16908 17961 bg090109r1    820 (  0)  1.11 0.91 0.10   12 ( 24)   48 ( 48) 
  16924 18012 af090109f1    681 (  0)  2.77 0.81 0.00  102 (121)  122 (203) 
C 16930 17951 eg120109f1    900 (  0)  0.10 0.00 0.00    0 (  0)   26 ( 26) 
  17026 18053 eh010109f1    311 (  0)  0.00 0.00 0.00   41 ( 33)  618 (618) 
  17259 18291 eg030109f1    898 (  0)  0.30 0.50 0.00   24 ( 24)    0 (  0) 
  17284 18335 df040109f1    831 (  0)  2.17 0.89 0.10   25 ( 25)   14 ( 14) 
C 17351 18411 bb020109r1    777 (  0)  2.18 1.35 0.10   48 (132)   48 ( 48) 
C 17357 18382 cg030109f1    919 (  0)  0.00 0.10 0.10    0 (  0)   25 ( 11) 
  17364 18392 ef110109r1    888 (  0)  0.51 0.10 0.10   46 ( 46)    0 (  0) 
C 17374 18383 dg020109f1    887 (  0)  0.30 0.51 0.00    1 ( 12)   21 ( 10) 
  17450 18559 bd060109r1    810 (  0)  0.54 0.97 0.00   52 ( 52)  129 (156) 
  17465 18480 da010109f1    853 (  0)  0.40 1.61 0.00   21 ( 31)    0 ( 35) 
C 17520 18561 de040109r1    908 (  0)  0.30 0.10 0.00    0 (  0)   46 ( 46) 
  17578 18612 ca040109r1    907 (  0)  0.00 0.30 0.00   43 ( 43)    3 (  0) 
  17583 18604 ch080109r1    884 (  0)  0.31 0.41 0.00   44 ( 44)    0 (  0) 
C 17626 18668 cd070109r1    904 (  0)  0.40 0.30 0.00    0 (  0)   45 ( 45) 
  17680 18741 ag110109f1    776 (  0)  0.97 1.40 0.11   26 ( 45)  110 (110) 
  17719 18752 eh040109r1    853 (  0)  0.51 1.33 0.00   49 ( 49)    4 ( 39) 
  17797 18872 ae030109r1    862 (  0)  0.61 0.81 0.10   48 ( 48)   44 ( 80) 
C 17861 18882 da010109r1    899 (351)  0.10 0.20 0.00    0 (  0)   44 ( 44) 
  17924 18964 da040109r1    924 (275)  0.30 0.00 0.00   49 ( 49)    0 (  0) 
  17950 18997 ed070109r1    917 (246)  0.20 0.30 0.10   49 ( 49)    5 (  0) 
  17988 19031 dg100109f1    953 (240)  0.00 0.20 0.00   24 ( 24)    6 (  1) 
  18039 19076 ce020109f1    963 (190)  0.00 0.10 0.00   22 ( 22)    0 (  0) 
C 18049 19059 ed110109f1    472 (  0)  0.00 0.20 0.00  496 (496)   23 ( 23) 
  18138 19171 bb110109r1    882 ( 61)  0.72 0.51 0.00   55 ( 55)    4 ( 12) 
C 18217 19323 ad080109r1    850 (  0)  1.15 0.73 0.00  106 (106)   47 ( 47) 
  18241 19309 dd060109f1    962 (  0)  0.19 0.48 0.10   22 ( 22)    0 (  0) 
  18303 19337 ea040109r1    925 (  0)  0.10 0.30 0.00   47 ( 47)    0 (  0) 
C 18321 19351 eg030109r1    907 (  0)  0.20 0.61 0.00    0 (  0)   46 ( 46) 
C 18320 19363 cf050109f1    937 (  0)  0.29 0.49 0.10    0 (  0)   24 ( 24) 
C 18386 19437 ce030109f1    909 (  0)  1.67 0.49 0.00    8 (  0)   26 ( 26) 
C 18422 19510 dd060109r1    973 (  0)  0.29 0.48 0.00    5 (  5)   48 ( 47) 
  18470 19518 bh040109f1    860 (  0)  1.42 1.52 0.00   29 ( 29)   33 ( 59) 
  18499 19505 ed110109r1    474 (  0)  0.00 0.00 0.00   48 ( 48)  469 (480) 
C 18509 19550 eh040109f1    955 (  0)  0.39 0.69 0.00    0 (  0)   21 ( 21) 
  18504 19572 ad020109f1    861 (  0)  2.86 0.89 0.10   46 ( 46)   10 ( 46) 
  18527 19543 de010109r1    945 (  0)  0.10 0.00 0.00   47 ( 41)    0 (  0) 
  18569 19588 ce110109f1    959 (  0)  0.00 0.20 0.10   23 ( 23)    0 (  0) 
C 18599 19689 af090109r1    804 (  0)  2.91 1.25 0.00   77 (183)   52 ( 52) 
C 18713 19813 bd060109f1    771 (126)  1.26 1.26 0.11   77 (142)  150 (150) 
  18708 19736 ee100109r1    942 (  0)  0.10 0.20 0.10   45 ( 45)    0 ( 21) 
  18718 19730 eg020109f1    926 (  0)  0.41 0.61 0.00   26 ( 26)    0 (  0) 
C 18763 19815 ag110109r1    878 (  0)  0.94 0.63 0.00   38 ( 61)   60 ( 60) 
C 18767 19824 eb060109r1    124 (  0)  0.00 1.46 0.00  876 (876)   45 ( 45) 
  18850 19899 de050109f1    985 (  0)  0.49 0.10 0.00   20 ( 20)    2 ( 24) 
  18860 19866 cg020109f1    958 (  0)  0.30 0.00 0.10   19 ( 22)    0 (  0) 
C 18926 19965 ef110109f1    971 (  0)  0.10 0.10 0.10    0 (  0)   29 ( 27) 
  19010 20039 cd030109r1    953 (  0)  0.00 0.10 0.00   42 ( 42)    0 (  0) 
C 19027 20074 ce020109r1    963 (  0)  0.00 0.20 0.10    0 (  0)   43 ( 43) 
  19032 20070 cf040109r1    935 (  0)  0.10 0.60 0.00   45 ( 45)    0 (  0) 
  19033 20079 bb090109r1    906 (  0)  0.71 0.61 0.00   44 ( 44)   21 ( 21) 
C 19038 20087 cc030109r1    958 (  0)  0.20 0.20 0.00    4 (  4)   44 ( 44) 
  19078 20145 ad020109r1    830 (  0)  2.99 0.41 0.10   43 ( 43)   55 (112) 
  19134 20164 cf060109r1    925 (  0)  0.41 0.20 0.00   46 ( 46)    8 (  8) 
C 19147 20200 df040109r1    957 (  0)  0.20 0.30 0.00    0 (  0)   47 ( 47) 
C 19249 20281 ch080109f1    973 (  0)  0.10 0.30 0.00    0 (  0)   22 ( 22) 
  19270 20302 ef090109f1    983 (  0)  0.10 0.10 0.00   22 ( 22)    0 (  0) 
  19275 20426 be030109r1    487 (  0)  5.28 0.80 0.16   47 ( 47)  480 (550) 
  19285 20313 bh110109f1    880 (  0)  1.26 0.52 0.00   36 ( 36)   38 ( 70) 
C 19342 20379 bb110109f1    912 (  0)  1.48 0.59 0.20    1 ( 42)   25 ( 22) 
C 19381 20400 ce110109r1    932 (  0)  0.31 0.31 0.00    0 (  0)   46 ( 43) 
C 19415 20458 dh040109f1    156 (  0)  0.00 0.61 0.00  854 (854)   25 ( 14) 
C 19443 20472 de010109f1    908 (  0)  0.10 0.73 0.00   44 ( 44)   24 ( 24) 
  19540 20594 ba060109r1    914 (  0)  1.21 0.50 0.00   48 ( 48)   16 ( 16) 
C 19602 20644 ea040109f1    994 (  0)  0.10 0.00 0.00    0 (  0)   24 ( 24) 
C 19616 20669 ed070109f1    992 (  0)  0.10 0.39 0.00    0 (  0)   21 ( 21) 
  19619 20679 eb060109f1    121 (  0)  0.00 1.48 0.00   24 ( 24)  902 (902) 
C 19623 20667 da040109f1    979 (  0)  0.29 0.20 0.00    3 (  0)   22 ( 22) 
C 19643 20694 cf060109f1   1002 (  0)  0.00 0.10 0.00    0 (  0)   21 ( 21) 
  19654 20683 eg090109r1    962 (  0)  0.00 0.00 0.00   45 ( 45)    0 (  0) 
  19707 20738 ce060109f1    976 (  0)  0.10 0.10 0.10   21 ( 21)    0 (  0) 
C 19718 20779 dg100109r1    971 (  0)  0.10 0.20 0.10    0 (  0)   50 ( 50) 
  19765 20794 ec100109f1    981 (  0)  0.00 0.00 0.10   22 ( 22)    0 (  0) 
C 19788 20847 bh040109r1    840 (  0)  1.57 1.26 0.00   53 (100)   51 ( 51) 
C 19807 20864 bb090109f1    910 (  0)  1.56 0.59 0.29    8 ( 75)   27 ( 15) 
C 19811 20860 cf040109f1    997 (  0)  0.19 0.00 0.00    1 (  1)   23 ( 12) 
  19878 20927 dd070109r1    961 (  0)  0.30 0.30 0.00   48 ( 48)    0 (  0) 
C 20002 21036 ce060109r1    939 (  0)  0.10 0.40 0.20    1 (  1)   44 ( 44) 
  20129 21163 df070109f1    983 ( 56)  0.10 0.20 0.00   19 ( 19)    0 (  0) 
  20216 21267 dh040109r1    136 (  0)  1.26 1.89 0.00   59 ( 59)  834 (823) 
C 20226 21242 eg020109r1    900 (  0)  0.41 0.62 0.21    0 (  0)   46 ( 46) 
C 20247 21329 ae030109f1    901 (  0)  1.60 0.60 0.00   55 ( 85)   25 ( 25) 
C 20346 21392 ee100109f1    976 (  0)  0.20 0.20 0.10    0 (  0)   24 ( 27) 
  20359 21367 ed120109f1    934 (  0)  0.61 0.00 0.10   22 ( 22)    0 (  0) 
  20394 21437 dc030109r1    967 (  0)  0.00 0.00 0.00   44 ( 44)    0 (  0) 
C 20404 21473 de050109r1    967 (  0)  0.69 0.00 0.00    2 (  2)   47 ( 47) 
  20421 21524 ab040109f1    992 (  0)  0.19 0.38 0.00   24 ( 24)   28 ( 28) 
  20476 21507 dc100109f1    772 (152)  0.24 0.12 0.12   21 ( 21)  193 (193) 
  20602 21640 dd100109f1    942 (  0)  0.40 0.30 0.00   22 ( 22)   12 ( 32) 
C 20631 21681 ca040109f1    957 (  0)  0.29 0.49 0.00    1 (  1)   24 ( 24) 
C 20691 21726 bh110109r1    846 (  0)  1.55 1.04 0.00   20 ( 61)   50 ( 50) 
  20775 21845 ab050109r1    912 (  0)  1.18 0.69 0.00   47 ( 47)    6 ( 49) 
  20805 21849 dh100109r1    930 (  0)  0.40 0.10 0.20   46 ( 46)    0 (  0) 
  20925 21982 ef080109f1    974 (  0)  0.10 0.19 0.00   22 ( 22)    3 (  3) 
  20956 21971 df010109r1    905 (  0)  0.00 0.42 0.00   48 ( 48)    5 (  0) 
  21007 22048 cc040109r1    893 (  0)  0.10 1.40 0.10   42 ( 42)    0 ( 34) 
C 21008 22029 cg020109r1    918 (  0)  0.20 0.10 0.10    0 (  0)   45 ( 45) 
  21030 22020 ca120109r1    902 (  0)  0.00 0.00 0.00   47 ( 47)    0 (  0) 
  21060 22130 bd070109f1    886 (  0)  1.10 0.90 0.10   23 ( 23)   44 ( 84) 
C 21097 22137 ec100109r1    942 (  0)  0.00 0.20 0.00    2 (  2)   46 ( 46) 
  21121 22137 dg050109f1    892 (  0)  0.60 0.20 0.70   23 ( 23)    0 ( 37) 
C 21188 22251 ba060109f1    899 (  0)  1.57 0.49 0.10   18 ( 86)   26 ( 26) 
  21312 22364 bb010109r1    401 (  0)  0.46 0.23 0.00   48 ( 48)  570 (570) 
  21327 22389 ba070109r1    831 (  0)  0.22 1.30 0.00   49 ( 49)   92 (132) 
C 21357 22492 be030109f1    473 (  0)  8.62 1.25 0.56  397 (508)   20 ( 20) 
C 21414 22542 bd070109r1    705 (  0)  2.13 1.54 0.24  198 (263)   86 (109) 
C 21468 22512 eg090109f1    965 (  0)  0.30 0.20 0.00    0 (  0)   29 ( 29) 
  21512 22568 cc060109f1    959 (  0)  0.39 0.68 0.10   21 ( 21)    3 (  3) 
  21617 22620 cc110109f1    949 (  0)  0.00 0.10 0.00   23 ( 23)    0 (  0) 
  21622 22638 cb100109f1    955 (  0)  0.00 0.30 0.00   21 ( 21)    1 (  1) 
  21723 22772 bb100109f1    928 (  0)  0.88 0.78 0.10   26 ( 24)    3 ( 35) 
  21895 22956 bf070109r1    908 (  0)  0.81 0.41 0.20   49 ( 49)   28 ( 28) 
  22220 23245 cc100109f1    981 (  0)  0.10 0.10 0.00   20 ( 20)    0 (  0) 
C 22317 23354 df070109r1    939 (  0)  0.81 0.20 0.00    0 ( 20)   45 ( 45) 
  22390 23406 eh020109r1    906 (  0)  1.03 0.21 0.00   47 ( 47)    0 (  8) 
  22459 23494 df030109r1    951 (  0)  0.20 0.10 0.00   44 ( 44)    0 (  5) 
C 22486 23531 dd100109r1    942 (  0)  0.70 0.10 0.00    3 ( 22)   50 ( 50) 
C 22527 23576 dh100109f1    980 (  0)  0.00 0.29 0.10    0 (  0)   23 ( 23) 
C 22553 23649 ab050109f1    926 (  0)  0.89 0.70 0.00   65 (117)   25 ( 25) 
  22605 23582 eb120109f1    929 (  0)  0.00 0.00 0.00   21 ( 21)    0 (  0) 
C 22641 23688 dg050109r1    970 (  0)  0.00 0.00 0.00    3 (  3)   48 ( 48) 
  22652 23661 cg110109f1    957 (  0)  0.00 0.00 0.10   21 ( 21)    0 (  0) 
  22687 23675 eb110109r1    920 (  0)  0.00 0.00 0.00   43 ( 43)    0 (  0) 
C 22716 23749 cc100109r1    957 (  0)  0.10 0.10 0.00    0 (  5)   44 ( 44) 
C 22901 23961 bf100109f1    897 (  0)  1.11 0.41 0.41   50 ( 83)   24 ( 28) 
  22904 23911 dc080109f1    926 (  0)  0.31 0.10 0.41   20 ( 20)    8 (  3) 
C 22924 24028 ab040109r1    997 (  0)  0.76 0.28 0.00    0 (  5)   47 ( 47) 
C 22941 23985 cd030109f1    994 (  0)  0.00 0.10 0.00    0 (  0)   24 ( 24) 
C 23058 24087 df010109f1    948 (  0)  0.50 0.00 0.10    3 (  3)   29 ( 29) 
C 23087 24153 bf070109f1    932 (  0)  1.17 0.39 0.10   13 ( 56)   24 ( 23) 
C 23101 24166 cc060109r1    968 (  0)  0.10 0.20 0.10    0 (  0)   45 ( 45) 
C 23105 24116 ca120109f1    937 (  0)  0.00 0.00 0.00    0 (  0)   39 ( 39) 
  23112 24122 dh070109f1    938 (  0)  0.30 0.20 0.00   22 ( 24)    1 (  1) 
  23205 24215 dh110109r1    912 (  0)  0.31 0.31 0.00   48 ( 48)    0 (  0) 
C 23215 24304 dc030109f1    792 (  0)  2.16 0.97 0.22  138 (201)   25 ( 25) 
  23226 24207 dh010109r1    899 (  0)  0.21 0.11 0.00   46 ( 46)    0 (  0) 
C 23246 24375 ba090109r1     32 (  0)  23.33 1.43 0.95  572 (717)  348 (382) 
C 23257 24261 dg010109f1    333 (  0)  0.28 0.00 0.00  628 (628)   23 ( 23) 
  23288 24299 cc070109f1    936 (  0)  0.10 0.10 0.20   27 ( 27)    1 (  1) 
C 23308 24366 bb100109r1    877 (  0)  1.22 0.82 0.00   31 ( 57)   48 ( 48) 
  23310 24325 da070109f1    896 (  0)  0.20 1.02 0.10   24 ( 24)   12 ( 12) 
  23344 24389 eb070109r1    953 (  0)  0.00 0.20 0.00   50 ( 50)    0 (  0) 
C 23365 24417 ba070109f1    929 (  0)  0.68 0.88 0.00    0 (  0)   28 ( 28) 
  23372 24385 ba120109f1    874 (  0)  1.05 0.63 0.00   23 ( 26)   35 ( 35) 
  23410 24451 ee030109r1    866 (  0)  1.41 1.31 0.10   44 ( 44)    3 (111) 
C 23409 24413 cc110109r1    930 (  0)  0.10 0.00 0.00    0 (  0)   41 ( 41) 
  23443 24455 dg070109f1    915 (  0)  1.01 0.20 0.10   27 ( 27)    0 (  0) 
C 23499 24551 dd070109f1    968 (  0)  0.39 0.39 0.00    3 (  3)   22 ( 22) 
  23603 24704 bf050109f1    873 (  0)  0.52 1.04 0.10   20 ( 25)  119 (158) 
  23617 24689 bb050109r1    862 (  0)  2.45 0.78 0.29   46 ( 46)    5 ( 92) 
C 23631 24695 ef080109r1    928 (  0)  0.79 0.69 0.00    6 ( 48)   46 ( 46) 
C 23660 24641 dh010109f1    913 (  0)  0.31 0.10 0.00    1 (  1)   22 ( 22) 
  23694 24748 dc050109r1    906 (  0)  0.10 0.91 0.00   45 ( 45)   24 ( 10) 
C 23817 24836 eh020109f1    881 (  0)  0.41 0.91 0.20   12 ( 50)   22 ( 22) 
  23841 24841 dg010109r1    312 (  0)  2.26 0.00 0.00   44 ( 44)  603 (603) 
  23857 24897 ec090109f1    963 (  0)  0.20 0.00 0.00   24 ( 24)    2 (  2) 
  23903 24975 ah100109f1    721 (  0)  1.16 1.97 0.12   85 ( 98)  123 (158) 
  24015 25014 da120109f1    919 (  0)  0.31 0.10 0.00   24 ( 24)    0 (  0) 
C 24034 25068 df030109f1    927 (  0)  0.50 0.50 0.00    4 (  4)   26 ( 26) 
  24052 25066 dh120109f1    942 (  0)  0.30 0.00 0.00   23 ( 23)    0 (  0) 
C 24145 25163 cb100109r1    929 (  0)  0.00 0.00 0.00    1 (  1)   46 ( 46) 
C 24201 25252 cc040109f1    958 (  0)  0.29 0.19 0.00    2 (  2)   24 ( 28) 
C 24207 25201 eb110109f1    921 (  0)  0.21 0.00 0.00    0 (  0)   21 ( 21) 
C 24227 25276 dc050109f1    951 (  0)  0.78 0.19 0.00    0 (  0)   21 ( 21) 
  24307 25382 be080109f1    933 (  0)  1.45 0.39 0.00   25 ( 25)   19 ( 23) 
  24424 25497 cf080109r1    980 (  0)  0.00 0.10 0.00   49 ( 49)    0 (  0) 
C 24475 25532 ah100109r1    816 (  0)  1.09 0.87 0.11   93 ( 93)   48 ( 48) 
  24483 25508 dh030109f1    952 (  0)  0.10 0.00 0.00   20 ( 25)   15 ( 10) 
C 24511 25525 ea110109r1    326 (  0)  12.93 3.13 0.14  157 (333)  123 (191) 
C 24518 25541 dh030109r1    938 (  0)  0.00 0.00 0.00    0 (  0)   48 ( 43) 
  24544 25583 ch040109f1    958 (  0)  0.39 0.10 0.00   22 ( 22)    0 (  5) 
C 24544 25515 eb120109r1    895 (  0)  0.00 0.00 0.00    1 (  1)   40 ( 40) 
  24554 25583 dg120109r1    936 (  0)  0.20 0.00 0.00   46 ( 46)    1 (  1) 
  24569 25607 af010109r1    817 (  0)  1.05 1.69 0.00   48 ( 18)   42 ( 85) 
  24569 25605 eg060109r1    854 (  0)  1.02 1.33 0.00   46 ( 16)   14 ( 72) 
C 24721 25741 dh070109r1    931 (  0)  0.00 0.00 0.10    0 (  0)   48 ( 48) 
  24769 26034 eb010109f1     42 (  0)  19.23 0.00 0.00  195 (220)  967 (1029) 
  24788 25833 eb020109f1    912 (  0)  0.50 0.60 0.00   24 ( 24)   29 ( 24) 
C 24883 25907 dg070109r1    939 (  0)  0.00 0.00 0.00    0 (  0)   46 ( 46) 
  24932 25958 ce100109r1    909 (  0)  0.31 0.10 0.00   45 ( 45)   17 ( 17) 
  25024 26038 ec110109f1    941 (  0)  0.20 0.00 0.00   25 ( 25)    0 (  4) 
C 25058 26058 ba120109r1    847 (  0)  0.53 0.74 0.21   11 ( 11)   47 ( 47) 
C 25068 26110 ee030109f1    879 (  0)  1.99 0.60 0.00   16 ( 27)   21 ( 20) 
  25075 26140 ba080109r1    927 (  0)  0.88 0.49 0.00   46 ( 46)    3 ( 26) 
  25075 26130 de080109r1    914 (  0)  0.70 0.50 0.00   45 ( 45)   14 ( 13) 
  25075 26121 ch100109r1    935 (  0)  0.50 0.10 0.00   45 ( 45)    5 (  4) 
C 25148 26172 ec090109r1    931 (  0)  0.20 0.00 0.00    0 (  0)   48 ( 48) 
  25166 26171 db110109f1    934 (  0)  0.20 0.10 0.00   23 ( 23)    0 (  0) 
  25193 26261 cb050109f1    962 (  0)  0.87 0.39 0.00   20 ( 20)   12 ( 21) 
C 25205 26204 cg110109r1    905 (  0)  0.21 0.00 0.00    5 (  0)   46 ( 46) 
C 25350 26370 cc070109r1    939 (106)  0.21 0.00 0.00    0 ( 10)   47 ( 47) 
  25364 26356 db060109f1    626 (  0)  2.61 0.65 1.05   20 ( 20)  208 (266) 
C 25424 26411 da120109r1    918 (151)  0.00 0.00 0.00    0 (  0)   39 ( 39) 
  25456 26497 cg050109r1    967 (267)  0.00 0.00 0.00   47 ( 47)    2 (  1) 
  25480 26524 ah120109r1    790 (137)  2.07 0.87 0.33   46 ( 46)   82 (126) 
  25494 26556 ec050109r1    946 (280)  0.49 0.69 0.00   46 ( 46)    1 ( 45) 
  25492 26518 ch020109f1    970 (286)  0.10 0.00 0.10   23 ( 23)    0 (  0) 
C 25558 26557 dc080109r1    665 (282)  3.05 1.52 0.13  166 (262)   47 ( 47) 
C 25614 26621 dh110109f1    953 (  0)  0.10 0.10 0.10    1 (  1)   22 ( 22) 
C 25644 26666 af010109f1    887 (  0)  1.00 1.40 0.10    0 ( 49)   24 ( 24) 
C 25676 26710 eb070109f1    983 (  0)  0.10 0.00 0.00    0 (  0)   25 ( 21) 
C 25702 26724 da070109r1    938 (  0)  0.31 0.10 0.10    0 (  0)   46 ( 46) 
  25711 26738 bb120109r1    873 (  0)  1.34 0.62 0.21   48 ( 48)   12 ( 54) 
C 25746 26855 bf050109r1    819 (523)  1.75 0.77 0.00  145 (154)   51 ( 51) 
  25798 26846 ca030109f1    985 (  0)  0.29 0.10 0.00   25 ( 24)    5 (  0) 
  25802 26863 ba050109f1    947 (  0)  1.16 0.68 0.00   25 (  7)    0 ( 69) 
  25804 26850 ea030109f1    989 (  0)  0.39 0.00 0.00   23 (  6)    0 ( 10) 
C 25813 26845 ce100109f1    970 (  0)  0.20 0.20 0.00    3 (  3)   23 ( 23) 
C 25814 26906 ae070109f1     44 (  0)  0.00 0.00 0.00 1021 (1021)   24 ( 24) 
C 25883 26939 ba080109f1    950 (525)  0.87 0.78 0.00    1 (  3)   25 ( 25) 
C 25886 26921 ch040109r1    933 (  0)  0.61 0.30 0.00    2 (  0)   49 ( 49) 
C 25894 26932 ca030109r1    958 (  0)  0.40 0.00 0.00    1 (  1)   46 ( 46) 
  25898 26939 cg080109f1    942 (  0)  0.39 1.17 0.00   19 ( 18)    0 (  0) 
C 25912 26949 de080109f1    967 (528)  0.20 0.39 0.10    0 (  0)   20 ( 10) 
C 25926 26991 be080109r1    907 (494)  1.08 1.28 0.00    1 ( 58)   50 ( 50) 
C 25915 26951 ch100109f1    972 (  0)  0.10 0.20 0.10    3 (  0)   22 ( 13) 
  25952 27035 bd080109f1    551 (536)  0.00 0.00 0.00   27 ( 27)  496 (496) 
C 26226 27239 dh120109r1    934 (280)  0.10 0.10 0.00    0 (  0)   46 ( 46) 
C 26240 27278 db060109r1    942 (250)  0.40 0.30 0.00    0 (  0)   44 ( 44) 
C 26436 27437 ec110109r1    924 ( 84)  0.00 0.10 0.00    0 (  0)   47 ( 47) 
C 26445 27477 eg060109f1    924 ( 34)  0.70 0.60 0.00    9 ( 48)   28 ( 28) 
  26466 27511 cf020109r1    960 ( 30)  0.10 0.00 0.00   43 ( 43)    8 (  4) 
  26526 27560 aa110109r1    861 (  0)  1.64 0.31 0.41   50 ( 16)   11 ( 50) 
  26527 27568 dg090109r1    942 (  0)  0.40 0.10 0.00   49 ( 15)    0 (  0) 
  26595 27634 de070109f1    942 (  0)  0.10 0.60 0.10   22 ( 22)   10 ( 10) 
C 26610 27673 cf080109f1    976 (  0)  0.48 0.10 0.19    0 (  0)   23 ( 23) 
C 26696 27719 dg120109f1    951 (  0)  0.10 0.20 0.00    0 (  0)   32 ( 28) 
C 26704 27725 bb120109f1    912 (  0)  1.31 0.40 0.00    0 ( 39)   29 ( 31) 
C 26720 27808 bb050109f1    928 (  0)  0.30 0.60 0.10   64 ( 77)   28 ( 28) 
C 26721 27723 db110109r1    923 (  0)  0.21 0.00 0.00    0 (  0)   46 ( 46) 
C 26761 27777 ch020109r1    943 (  0)  0.00 0.00 0.00    0 (  0)   43 ( 43) 
  26789 27882 ae070109r1     33 (  0)  8.33 0.00 0.00   46 ( 46) 1000 (1016) 
C 26878 27927 aa100109r1    255 (  0)  0.74 0.00 0.00  731 (731)   49 ( 49) 
C 26894 27963 ba050109r1    866 (  0)  0.31 1.46 0.00   65 ( 65)   48 ( 18) 
C 26894 27997 ah120109f1    305 (  0)  14.38 1.42 0.32  338 (487)  133 (131) 
C 26892 27930 cg080109r1    941 (  0)  0.30 0.20 0.10    0 (  0)   47 ( 47) 
C 26921 27959 ea030109r1    946 (  0)  0.20 0.30 0.00    1 (  1)   44 ( 14) 
  26989 28045 aa030109f1    922 (  0)  1.08 0.78 0.20   25 ( 27)    9 (  5) 
  27012 28046 eb030109f1    961 (  0)  0.10 0.40 0.00   22 ( 22)    5 (  7) 
  27040 28028 db120109r1    916 (  0)  0.00 0.00 0.00   44 ( 44)    1 (  1) 
C 27102 28249 ed020109r1     36 (  0)  0.00 0.00 0.00 1062 (1062)   48 ( 48) 
  27146 28174 bg110109f1    925 (  0)  1.19 0.30 0.10   24 ( 24)    0 ( 42) 
C 27148 28168 cg050109f1    960 (156)  0.40 0.10 0.00    0 (  5)   21 ( 21) 
C 27240 28329 cb050109r1    819 (  0)  1.20 1.20 0.00  128 (193)   46 ( 46) 
C 27371 28467 cf010109r1    232 (  0)  0.41 0.41 0.00  806 (798)   47 ( 47) 
C 27523 28554 eb030109r1    948 (  0)  0.20 0.10 0.00    8 (  8)   46 ( 46) 
C 27536 28564 aa110109f1    893 (  0)  1.40 1.00 0.00    5 ( 16)   26 ( 17) 
C 27534 28561 dg090109f1    953 (  0)  0.30 0.40 0.10    0 (  4)   23 ( 14) 
C 27565 28617 dd030109f1    728 (  0)  4.38 2.34 0.20   46 (216)   25 ( 25) 
C 27548 28581 eb020109r1    907 (  0)  0.32 0.32 0.00   42 ( 42)   43 ( 40) 
  27576 28643 ag090109r1    906 (  0)  0.51 0.72 0.00   46 ( 46)   50 ( 74) 
  27581 28639 aa100109f1    230 (  0)  3.01 0.38 0.00   32 ( 32)  761 (761) 
C 27596 28611 bf120109f1    894 (  0)  1.42 0.30 0.30    3 (  2)   24 ( 24) 
  27646 28682 ca060109f1    735 (  0)  6.98 1.00 0.00   32 (149)    2 (  2) 
  27650 28680 eh060109f1    963 (  0)  0.20 0.30 0.00   22 ( 22)    0 (  0) 
  27767 28805 ec070109r1    950 (  0)  0.10 0.00 0.00   46 ( 46)    5 (  0) 
  27891 28927 ch060109f1    961 (  0)  0.00 0.20 0.00   32 ( 32)    0 (  0) 
C 27969 28999 de070109r1    878 (  0)  0.93 0.62 0.10   15 ( 52)   44 ( 44) 
C 28025 29045 eh060109r1    915 (  0)  0.51 0.10 0.00    0 ( 10)   47 ( 47) 
C 28063 29090 bg110109r1    838 (  0)  0.64 1.06 0.11   41 ( 75)   48 ( 48) 
  28113 29355 ed020109f1     35 (  0)  2.00 2.00 2.00   34 ( 34) 1159 (1159) 
  28119 29167 ef070109r1    946 (  0)  0.40 0.00 0.00   47 ( 47)    1 (  5) 
  28152 29225 cf010109f1    239 (  0)  0.00 0.00 0.00   25 ( 17)  805 (805) 
  28334 29413 af080109f1    931 (  0)  1.05 0.48 0.38   26 ( 26)    5 ( 33) 
  28530 29569 cg090109f1    955 (  0)  0.29 0.10 0.00   22 ( 22)    0 (  5) 
C 28569 29612 aa030109r1    887 (  0)  0.90 0.80 0.10    1 ( 36)   46 ( 46) 
C 28569 29589 ch060109r1    921 (  0)  0.20 0.00 0.00    0 (  0)   45 ( 45) 
  28623 29716 ad070109r1    840 (  0)  0.98 0.00 0.11   49 ( 49)  131 (147) 
  28630 29647 ah010109r1    763 (  0)  2.68 0.45 0.00   47 ( 47)   77 (125) 
C 28690 29762 ag090109f1    813 (  0)  1.20 1.09 0.00   70 ( 89)   85 ( 85) 
C 28763 29868 ab100109f1     85 (  0)  1.94 0.00 0.00  917 (917)   86 ( 86) 
C 28846 29874 ca060109r1    159 (  0)  20.67 3.95 0.23  121 (146)   47 (845) 
  28899 29968 dd080109f1    847 (  0)  1.06 0.53 0.11   22 ( 22)  108 (138) 
  28920 29970 ae020109r1    893 (  0)  1.40 0.30 0.20   48 ( 48)    1 ( 56) 
C 28940 30019 ad070109f1    924 (  0)  1.05 1.05 0.10    2 ( 47)   26 ( 26) 
C 29036 30082 ef070109f1    952 (  0)  0.29 0.10 0.00    1 (  1)   28 ( 28) 
C 29054 30096 cf020109f1    943 (  0)  0.79 0.00 0.00    0 ( 11)   24 ( 24) 
C 29102 30184 ec050109f1    825 (  0)  1.65 0.93 0.00   87 (135)   29 ( 32) 
  29226 30253 eg010109f1    709 (  0)  1.00 0.50 0.00   24 ( 24)  202 (230) 
  29271 30286 ce010109r1    865 (  0)  0.31 0.31 0.00   45 ( 45)    3 ( 19) 
  29361 30513 ah070109r1    335 (112)  2.44 0.00 0.00   48 ( 48)  696 (696) 
C 29448 30482 ec070109f1    914 (  0)  0.00 0.20 0.00    1 (  1)   20 ( 20) 
C 29462 30445 db120109f1    872 (  0)  0.10 0.00 0.00    0 (  0)   22 ( 22) 
C 29484 30554 af080109r1    869 (  0)  0.90 0.30 0.00   25 ( 40)   48 ( 48) 
  29520 30589 ad090109f1    849 (  0)  0.90 1.00 0.00   26 ( 16)   44 ( 54) 
  29522 30586 ec060109f1    892 ( 32)  0.67 0.96 0.00   24 ( 15)    1 ( 11) 
  29631 30744 ab100109r1    133 ( 46)  3.09 0.00 0.00   49 (1114)  903 (1113) 
  29751 30786 ae120109r1    736 ( 68)  2.67 0.43 0.00   45 ( 45)   53 ( 73) 
C 29852 30888 dd090109r1    337 (105)  0.00 0.00 0.27  627 (616)   46 ( 46) 
  29934 30972 ef100109r1    894 (111)  0.30 0.10 0.10   44 ( 44)    0 (  0) 
C 30167 31238 ah070109f1    846 (105)  0.91 1.31 0.00   53 ( 75)   29 ( 29) 
  30189 31239 ee070109r1    926 (111)  0.20 0.00 0.20   47 ( 47)    0 (  0) 
  30214 31278 aa040109r1    918 (105)  0.49 0.59 0.00   50 ( 50)    0 (  0) 
C 30253 31298 ae020109f1    847 (108)  1.08 1.86 0.10    1 ( 28)   26 ( 33) 
  30261 31329 ab030109f1    936 (105)  0.77 0.58 0.00   27 ( 27)    5 ( 38) 
  30276 31323 cc030109f1    965 (111)  0.00 0.00 0.10   20 ( 20)    0 (  0) 
C 30374 31400 cg090109r1    912 (112)  0.20 0.20 0.00    0 (  0)   47 ( 47) 
  30401 31455 bd110109f1    861 (109)  0.63 0.63 0.00   26 ( 26)   79 ( 79) 
C 30423 31490 ec060109r1    867 ( 91)  1.00 1.30 0.10   22 ( 43)   47 ( 47) 
C 30432 31491 ad090109r1    899 ( 85)  0.80 0.70 0.00   13 ( 33)   49 ( 49) 
  30458 31494 dd090109f1    333 (103)  0.00 0.27 0.27   21 ( 11)  652 (652) 
C 30689 31728 ef100109f1    975 (  0)  0.10 0.10 0.00    0 (  0)   21 ( 21) 
  30941 32045 ag050109r1    901 (  0)  1.37 0.98 0.00   50 ( 50)   34 (123) 
C 30983 32024 eg010109r1    566 (  0)  2.96 0.31 0.00  359 (380)   41 ( 41) 
C 30996 32003 ah010109f1    912 (  0)  0.92 0.00 0.31    3 ( 19)   26 ( 31) 
C 31008 32021 ce010109f1    959 (  0)  0.00 0.00 0.00    0 (  0)   23 ( 23) 
C 31026 32070 ee070109f1    972 (  0)  0.49 0.00 0.00    0 (  4)   21 ( 21) 
C 31116 32171 aa040109f1    921 (  0)  1.27 0.29 0.29   12 ( 53)   22 ( 22) 
  31160 32172 bh010109r1    841 (  0)  1.28 0.43 0.32   50 ( 50)   28 ( 44) 
  31179 32243 ce090109f1    995 (  0)  0.19 0.19 0.00   22 ( 26)    3 (  3) 
C 31270 32324 dd080109r1    965 (  0)  0.10 0.20 0.00    1 (  1)   44 ( 44) 
C 31335 32402 ab030109r1    876 (  0)  1.32 0.81 0.00   37 ( 68)   47 ( 47) 
  31541 32610 de090109f1    973 (  0)  0.38 0.67 0.10   15 ( 25)    4 ( 34) 
C 31602 32712 bb080109f1    598 (  0)  8.79 1.30 0.11  157 (316)   33 ( 93) 
C 31661 32711 bd110109r1    818 (  0)  0.75 1.71 0.00   67 ( 80)   47 ( 47) 
  31664 32698 eg040109f1    946 (  0)  0.50 0.20 0.00   20 ( 20)    7 ( 12) 
C 31701 32760 ae120109f1    720 (  0)  1.16 2.32 0.00   85 ( 26)  112 (112) 
  31855 32884 cd090109f1    950 (  0)  0.10 0.20 0.10   20 ( 20)    0 (  0) 
  32132 33200 ae100109r1    871 (  0)  1.61 0.80 0.00   49 ( 49)   24 (107) 
  32272 33360 bg050109f1    957 (  0)  1.13 0.47 0.00   26 ( 26)    5 ( 14) 
C 32325 33326 bh010109f1    859 (  0)  1.13 1.13 0.00    2 ( 99)   24 ( 24) 
  32400 33444 ee020109r1    905 (  0)  0.90 0.20 0.10   50 ( 50)    0 (  0) 
  32607 33671 bg070109r1    842 (  0)  2.17 1.28 0.20   45 ( 45)    5 ( 81) 
  32651 33647 dc120109f1    915 (  0)  0.31 0.21 0.00   24 ( 24)    0 (  0) 
  32722 33773 af020109r1    894 (  0)  0.92 0.61 0.00   47 ( 47)   24 ( 46) 
  32756 33758 ef120109r1    916 (  0)  0.00 0.10 0.00   45 ( 45)    1 (  1) 
  32874 33936 dd050109r1    983 (  0)  0.00 0.00 0.00   44 ( 44)    0 (  0) 
  32908 33930 ca080109f1    963 (  0)  0.00 0.10 0.00   21 ( 21)    0 (  0) 
C 32976 34009 cd090109r1    918 (  0)  0.51 0.31 0.00    5 ( 16)   50 ( 50) 
  33060 34078 ea020109f1    964 (  0)  0.00 0.00 0.00   21 ( 21)    0 (  0) 
C 33078 34168 ag050109f1    940 (  0)  0.75 1.32 0.19    4 ( 21)   24 ( 24) 
C 33124 34276 bg050109r1    724 (  0)  0.48 2.16 0.00  273 (302)   46 ( 46) 
C 33122 34185 de090109r1    971 (  0)  0.30 0.10 0.00    3 (  3)   45 ( 45) 
  33306 34362 cc050109f1    985 (  0)  0.10 0.10 0.00   26 ( 26)    0 (  0) 
  33320 34339 bg010109f1    870 (  0)  0.83 0.52 0.21   23 ( 23)   38 (105) 
  33360 34415 ee080109f1    988 (  0)  0.10 0.00 0.00   27 ( 27)    0 (  0) 
  33431 34461 db100109r1    934 (  0)  0.10 0.30 0.10   46 ( 46)    0 (  0) 
  33548 34590 ce080109r1    948 (  0)  0.20 0.30 0.00   42 ( 42)    0 (  0) 
C 33568 34597 eg040109r1    930 (  0)  0.71 0.00 0.00    0 (  0)   47 ( 47) 
  33739 34767 ch090109f1    928 (  0)  0.20 0.70 0.00   26 ( 26)    0 (  0) 
C 33767 34932 ef050109f1     98 (  0)  1.74 0.87 0.87 1030 (1021)   21 ( 21) 
C 33816 34816 ef120109f1    935 (  0)  0.00 0.00 0.00    0 (  0)   28 ( 28) 
  33940 35051 ag070109r1    805 (  0)  0.56 0.90 0.00   50 ( 50)  172 (172) 
  34012 35013 cc120109f1    931 (  0)  0.00 0.10 0.00   25 ( 25)    0 (  0) 
C 34041 35053 db100109f1    911 (  0)  0.51 0.41 0.00    1 (  5)   26 ( 26) 
C 34131 35127 dc120109r1    889 (  0)  0.31 0.10 0.00    0 (  0)   44 ( 44) 
  34162 35219 ac120109r1    794 (  0)  0.78 1.01 0.00   50 ( 88)  116 (116) 
C 34218 35274 af020109f1    930 (  0)  0.89 0.30 0.00    7 ( 28)   35 ( 35) 
C 34353 35399 ee020109f1    962 (  0)  0.29 0.10 0.00    0 (  4)   24 ( 24) 
C 34372 35433 dd050109f1    904 (  0)  0.49 1.17 0.20   15 ( 15)   23 ( 32) 
C 34522 35586 ce090109r1    937 (  0)  0.39 0.39 0.00    4 (  0)   47 ( 47) 
  34621 35634 eh120109f1    938 (  0)  0.30 0.00 0.10   23 ( 23)    0 (  0) 
  34745 35992 ef050109r1     45 (  0)  10.39 2.60 0.00   54 ( 42) 1117 (1157) 
C 34768 35790 ca080109r1    941 (  0)  0.10 0.00 0.00    0 (  0)   47 ( 47) 
C 34856 35926 bg070109f1    909 (  0)  1.00 0.80 0.00   40 ( 45)   26 ( 26) 
C 34963 36040 ae100109f1    912 (  0)  1.01 0.50 0.00   55 ( 90)   29 ( 29) 
  35086 36150 bd100109r1    889 (  0)  0.52 0.52 0.10   48 ( 48)   59 ( 59) 
C 35130 36179 cc050109r1    962 (  0)  0.20 0.20 0.00    0 (  0)   42 ( 42) 
C 35151 36181 ac120109f1    902 (  0)  1.39 0.70 0.00    0 ( 61)   24 ( 24) 
  35242 36250 df120109f1    948 (  0)  0.10 0.10 0.00   24 ( 24)    0 (  0) 
C 35252 36288 ce080109f1    936 (  0)  0.00 0.60 0.30    8 (  7)   21 ( 21) 
C 35268 36290 ch090109r1    936 (  0)  0.10 0.10 0.00    0 (  0)   50 ( 49) 
  35320 36401 af040109f1    963 (  0)  0.57 0.76 0.09   28 ( 28)    1 (  1) 
C 35372 36386 bg010109r1    822 (  0)  1.42 0.44 0.11   55 (101)   47 ( 47) 
C 35612 36655 ee080109r1    955 (  0)  0.30 0.10 0.00    0 (  5)   46 ( 46) 
C 35668 36710 eh080109r1    254 (  0)  0.00 0.00 0.00  738 (729)   46 ( 46) 
  35687 36719 dh080109r1    922 (  0)  0.61 0.30 0.00   45 ( 15)    0 (  0) 
  35686 36761 bh070109r1    793 (  0)  2.36 0.86 0.11   46 ( 16)   98 (144) 
  35717 36824 ad040109f1    745 (  0)  3.07 1.43 0.00   91 (103)  105 (209) 
  35728 36888 ad120109f1    516 (  0)  4.04 2.45 0.00  123 (150)  345 (488) 
  35728 36787 ed080109f1    962 (  0)  0.00 0.58 0.10   26 ( 26)    6 (  6) 
C 35800 36792 cc120109r1    910 (  0)  0.11 0.11 0.00    0 (  0)   45 ( 45) 
  35877 36935 bh060109r1    870 (  0)  1.72 0.71 0.00   47 ( 47)   26 ( 91) 
  35902 36949 dg060109r1    954 (  0)  0.00 0.10 0.00   49 ( 49)    2 (  2) 
C 35974 36990 ea020109r1    931 (  0)  0.00 0.00 0.00    0 (  0)   49 ( 49) 
  35986 36990 cf120109f1    942 (  0)  0.10 0.00 0.00   22 ( 22)    0 (  0) 
C 36005 37076 ag070109f1    901 (  0)  1.54 1.25 0.00    0 ( 58)   32 ( 32) 
  36088 37121 df110109f1    961 (  0)  0.00 0.30 0.10   23 ( 23)    0 (  0) 
  36260 37287 ee110109r1    950 (  0)  0.10 0.00 0.00   44 ( 44)    3 (  3) 
  36279 37355 dd040109f1    835 (  0)  2.42 1.41 0.00   24 ( 24)   62 (172) 
  36364 37437 ac070109f1    896 (  0)  0.72 0.51 0.10  101 (101)    0 (  0) 
  36382 37421 eh080109f1    246 (  0)  0.00 0.77 0.00   24 ( 15)  757 (757) 
  36850 37884 dg040109f1    977 (  0)  0.10 0.00 0.00   24 ( 16)    0 (  0) 
  36850 37892 cd080109f1    975 (  0)  0.29 0.00 0.00   24 ( 16)    2 (  2) 
C 36932 38000 af040109r1    920 (  0)  0.88 1.08 0.00    4 ( 53)   45 ( 45) 
C 37065 38135 bd100109f1    844 (  0)  1.06 0.64 0.00  106 (153)   26 ( 26) 
  37110 38184 ag030109r1    843 (  0)  1.72 1.01 0.20   53 ( 53)   32 ( 69) 
C 37163 38224 ag030109f1    855 (  0)  1.64 0.72 0.10   61 (115)   24 ( 28) 
C 37200 38198 eh120109r1    736 (  0)  1.26 1.60 0.23   79 (161)   44 ( 44) 
C 37267 38313 cd080109r1    934 (  0)  0.00 0.20 0.00    0 (  0)   49 ( 12) 
C 37284 38315 dg040109r1    908 (  0)  0.41 0.30 0.00    0 (  0)   48 ( 14) 
C 37285 38340 dd040109r1    929 (  0)  0.40 0.30 0.00    0 (  0)   46 ( 46) 
  37292 38399 bf040109r1    743 (  0)  2.48 1.51 0.22   46 ( 46)  134 (239) 
C 37395 38416 dg060109f1    936 (  0)  0.10 0.00 0.20    0 (  0)   18 ( 18) 
  37438 38559 ec030109r1    139 (  0)  16.87 6.77 0.27  113 (451)  256 (534) 
  37420 38606 ec040109r1     44 (  0)  26.97 0.84 0.00  298 (381)  533 (590) 
  37440 38506 ed040109r1    947 (  0)  0.39 0.20 0.10   43 ( 43)    0 (  5) 
C 37446 38507 bh070109f1    779 (  0)  3.34 0.73 0.10   76 (124)   29 ( 34) 
C 37481 38504 dh080109f1    924 (  0)  0.10 0.20 0.10    0 (  0)   31 ( 27) 
C 37509 38602 ad040109r1    571 (  0)  7.96 1.33 0.22  139 (301)   50 ( 98) 
  37593 38677 bh080109f1    847 (  0)  0.84 0.94 0.10   22 ( 22)  105 (105) 
C 37714 38738 df110109r1    920 (  0)  0.10 0.00 0.00    0 (  0)   46 ( 46) 
C 37735 38804 ac070109r1    872 (  0)  1.79 0.40 0.20   10 ( 62)   53 ( 53) 
C 37887 38936 ad120109r1    655 (  0)  2.15 1.55 0.12  168 (198)   44 ( 22) 
C 37892 38936 ed080109r1    904 (  0)  0.60 0.00 0.00    2 ( 17)   44 ( 22) 
  37958 38985 dd020109f1    860 (  0)  1.19 0.70 0.00   22 ( 22)    1 ( 16) 
C 38013 39076 bh080109r1    844 (  0)  1.13 0.21 0.10   45 ( 67)   48 ( 48) 
C 38144 39150 cf120109r1    877 (  0)  0.00 0.00 0.00    0 (  0)   46 ( 46) 
C 38229 39241 df120109r1    865 (  0)  0.10 0.21 0.10    2 (  2)   47 ( 47) 
  38288 39363 bd090109r1    768 (  0)  1.42 1.09 0.00   49 ( 49)  110 (201) 
C 38644 39737 bf040109f1    823 (  0)  0.41 1.76 0.00   98 (176)   29 ( 29) 
  38779 39782 ec120109f1    855 (  0)  0.31 1.13 0.00   29 ( 29)    0 (  9) 
C 38813 39843 dd020109r1    909 (  0)  0.10 0.10 0.00    0 (  0)   43 ( 43) 
C 38979 40036 ed040109f1    955 (  0)  0.19 0.29 0.10    0 (  0)   21 ( 21) 
C 39025 40073 bh060109f1    908 (  0)  0.98 0.10 0.49    0 (  0)   25 ( 25) 
  39065 40096 eb090109r1    913 (  0)  0.31 0.10 0.00   49 ( 49)    0 (  0) 
  39285 40460 ef020109f1    424 (  0)  4.49 1.90 0.00   26 ( 26)  571 (621) 
  39290 40345 db040109f1    914 (  0)  0.78 0.48 0.00   25 ( 25)    0 (  0) 
  39436 40512 aa050109r1    818 (  0)  0.76 0.22 0.00   48 ( 48)  109 (112) 
  39465 40508 ab120109f1    814 (  0)  1.06 0.74 0.11   29 ( 29)   68 (110) 
  39582 40651 ah050109f1    895 (  0)  0.41 0.10 0.10   25 ( 25)   69 ( 81) 
C 39710 40772 bd090109f1    873 (  0)  1.28 0.39 0.10   17 ( 56)   28 ( 28) 
C 39740 40806 ah050109r1    857 (  0)  0.91 0.70 0.00   23 ( 45)   50 ( 50) 
  39793 40949 ae080109r1    630 (  0)  2.26 1.76 0.00   52 ( 52)  310 (321) 
C 39800 40836 ee110109f1    913 (  0)  0.30 0.00 0.00    0 ( 10)   26 ( 26) 
C 39815 40951 ba030109f1    270 (  0)  1.86 0.00 0.62  789 (789)   26 ( 26) 
C 39818 40861 bc120109f1    188 (  0)  0.45 0.00 0.00  794 (794)   27 ( 13) 
  39855 40918 ee010109r1    358 (  0)  4.65 0.42 0.21   45 ( 45)  546 (623) 
C 39881 40929 ca050109r1    245 (  0)  0.36 0.00 0.00  728 (719)   45 ( 45) 
  39925 40992 aa080109r1    807 (  0)  1.95 0.61 0.10   47 ( 47)   45 (122) 
  40071 41207 bg080109r1    800 (  0)  1.93 1.63 0.00   45 ( 45)  109 (154) 
  40181 41208 cd020109r1    917 (  0)  0.00 0.00 0.00   48 ( 48)    0 (  0) 
C 40285 41321 eb090109f1    936 (  0)  0.10 0.10 0.00    0 (  0)   27 ( 27) 
C 40306 41469 ef020109r1    319 (  0)  2.03 0.25 0.00  726 (762)   44 ( 44) 
  40433 41493 be110109r1    802 (  0)  0.65 0.65 0.00   49 ( 49)   83 ( 87) 
  40519 41545 dc020109r1    883 (  0)  0.00 0.00 0.00   47 ( 47)    0 (  0) 
C 40537 41610 db040109r1    812 (  0)  1.01 1.31 0.00   29 ( 57)   50 ( 50) 
  40554 41624 ba030109r1    138 (  0)  17.19 0.00 0.00   50 ( 50)  701 (819) 
  40560 41630 bc120109r1    174 (  0)  1.79 0.45 0.00   52 ( 52)  796 (782) 
  40587 41641 ca050109f1    237 (  0)  0.00 0.00 0.72   22 ( 14)  757 (757) 
C 40695 41695 ec120109r1    847 (  0)  0.32 0.32 0.00    7 (  7)   48 ( 48) 
C 40960 41987 dc020109f1    834 (  0)  1.30 1.10 0.10    0 ( 62)   26 ( 26) 
C 41133 42166 ab120109r1    790 (  0)  2.15 0.41 0.72    0 ( 39)   55 ( 55) 
C 41329 42451 ae080109f1    643 (  0)  3.30 0.89 0.00  224 (228)  111 (111) 
C 41339 42475 bg080109f1    846 (  0)  1.20 1.30 0.00  113 (163)   27 ( 27) 
C 41370 42404 ee010109f1    423 (  0)  1.62 0.40 0.00  518 (518)   23 ( 23) 
C 41403 42490 aa050109f1    846 (  0)  0.74 0.63 0.00  110 (118)   26 ( 26) 
  41649 42683 cc090109f1    915 (  0)  0.20 0.20 0.10   25 ( 25)    1 (  1) 
C 41662 42710 df050109f1    661 (  0)  0.14 0.27 0.00  292 (292)   24 ( 10) 
C 41796 42864 aa080109f1    817 (  0)  1.94 1.36 0.29   13 (133)   24 ( 24) 
  41908 42950 df050109r1    669 (  0)  0.14 0.00 0.00   46 ( 46)  264 (251) 
C 42127 43212 cc010109f1    336 (  0)  12.50 2.04 0.41  170 (237)  180 (346) 
C 42155 43185 cd020109f1    893 (  0)  0.20 0.10 0.10    0 (  0)   24 ( 24) 
C 42660 43699 be110109f1    882 (  0)  0.69 0.10 0.00    2 (  2)   28 ( 28) 
C 42952 44090 bf060109f1     69 ( 33)  1.33 0.00 0.00 1047 (1046)   17 ( 17) 
  43036 44106 af030109f1    561 (  0)  0.46 0.15 0.15   32 ( 32)  392 (392) 
C 43155 44183 cc090109r1    802 (  0)  0.00 0.44 0.11    3 (  3)  119 (469) 
  43950 45009 ac110109r1     76 (  0)  1.22 0.00 0.00   49 ( 49)  929 (929) 
  43954 45082 bf060109r1     70 (  0)  3.66 0.00 0.00   45 ( 44) 1002 (1002) 

Overall discrep rates (%):             1.07 0.52 0.06

Contig quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 90   41303  93.7   41303  93.7    0.00
 89      24   0.1   41327  93.8    0.00
 88      67   0.2   41394  93.9    0.00
 87      26   0.1   41420  94.0    0.00
 86      42   0.1   41462  94.1    0.00
 85      65   0.1   41527  94.2    0.00
 84      52   0.1   41579  94.3    0.00
 83      45   0.1   41624  94.4    0.00
 82      28   0.1   41652  94.5    0.00
 81     214   0.5   41866  95.0    0.00
 80      23   0.1   41889  95.0    0.00
 79      21   0.0   41910  95.1    0.00
 78      28   0.1   41938  95.1    0.00
 77      19   0.0   41957  95.2    0.00
 76      70   0.2   42027  95.3    0.00
 75      21   0.0   42048  95.4    0.00
 74      26   0.1   42074  95.4    0.00
 73      17   0.0   42091  95.5    0.00
 72      12   0.0   42103  95.5    0.00
 71      19   0.0   42122  95.6    0.00
 70      16   0.0   42138  95.6    0.00
 69      10   0.0   42148  95.6    0.00
 68      13   0.0   42161  95.6    0.00
 67      16   0.0   42177  95.7    0.00
 66    1081   2.5   43258  98.1    0.00
 65      11   0.0   43269  98.2    0.00
 64      10   0.0   43279  98.2    0.00
 63      10   0.0   43289  98.2    0.00
 62       6   0.0   43295  98.2    0.00
 61     231   0.5   43526  98.7    0.00
 60      57   0.1   43583  98.9    0.00
 59       6   0.0   43589  98.9    0.00
 58       2   0.0   43591  98.9    0.00
 57       5   0.0   43596  98.9    0.00
 56     271   0.6   43867  99.5    0.00
 55      39   0.1   43906  99.6    0.00
 54      17   0.0   43923  99.6    0.00
 53      26   0.1   43949  99.7    0.00
 52      14   0.0   43963  99.7    0.00
 51      75   0.2   44038  99.9    0.00
 50       8   0.0   44046  99.9    0.00
 47       1   0.0   44047  99.9    0.00
 46       5   0.0   44052  99.9    0.00
 45      12   0.0   44064 100.0    0.00
 43      15   0.0   44079 100.0    0.00
 35       1   0.0   44080 100.0    0.00   (quality -1 = terminal quality 0)

Avg. full length: 44080.0, trimmed (qual > -1): 44080.0
Avg. quality: 88.6 per base

Initial, terminal qual 0 segments:  (None), (None)

Regions of LLR- adjusted quality < 2.0:


1 regions, avg size 0.0, avg spacing 44080.0

First_start: 1, last_end: 44080
 Unused pair: cb010109f1 ce040109r1  -7.8   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=1), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 0.7  trail: 0.0  lead: -11.1  total: -10.4   31  2.78 0.00 0.00  cb010109f1      130   165 (1089)  C ce040109r1   (938)    99    64 *
 Unused pair: be010109f1 ce040109r1  -7.8   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 0.7  trail: 0.0  lead: -11.1  total: -10.4   31  0.00 0.00 0.00  be010109f1       46    77 (971)  C ce040109r1   (938)    99    68 *
 Unused pair: bc010109f1 ce040109r1  -7.8   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=1), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 0.7  trail: 0.0  lead: -8.7  total: -8.0   31  2.78 0.00 0.00  bc010109f1      128   163 (902)  C ce040109r1   (938)    99    64 *
 Unused pair: ba100109f1 ce040109r1  -7.8   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=1), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 0.7  trail: 0.0  lead: -11.1  total: -10.4   31  2.78 0.00 0.00  ba100109f1      136   171 (870)  C ce040109r1   (938)    99    64 *
 Unused pair: bc050109f1 bc050109r1  2.7   1
LLR breakdown: discreps: -1.3 (<20 part: -1.3 (#=14), >20:0.0 (#=0); in HQ: -1.3, out HQ 0.0), match: 2.9  trail: 0.0  lead: 0.0  total: 1.6   98  5.84 1.95 1.30  bc050109f1       12   165 (944)  C bc050109r1   (900)   205    51 *
 Unused pair: ba040109r1 bc050109r1  3.0   1
LLR breakdown: discreps: -0.5 (<20 part: -0.5 (#=7), >20:0.0 (#=0); in HQ: 0.0, out HQ -0.5), match: 3.0  trail: 0.0  lead: 0.0  total: 2.5  108  3.57 1.43 0.00  ba040109r1      842   981 (93)    bc050109r1       51   192 (913)  
 Unused pair: ce040109r1 ea070109f1  -7.8   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=1), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 0.7  trail: -11.1  lead: 0.0  total: -10.4   32  2.78 0.00 0.00  ce040109r1       64    99 (938)  C ea070109f1   (860)   181   146 *
 Unused pair: ce040109r1 db020109f1  -7.8   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=1), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 0.7  trail: -11.1  lead: 0.0  total: -10.4   32  2.78 0.00 0.00  ce040109r1       64    99 (938)    db020109f1      280   315 (737) *
 Unused pair: ad030109r1 dg030109r1  -9.0   1
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=1), >20:0.0 (#=0); in HQ: 0.0, out HQ -0.1), match: 2.1  trail: -25.2  lead: 0.0  total: -23.2   83  0.00 1.06 0.00  ad030109r1      540   633 (446)  C dg030109r1   (4)  1054   960 *
 Unused pair: ad030109r1 ce120109f1  -7.5   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 3.6  trail: -25.2  total: -21.6  155  0.00 0.00 0.00  ad030109r1      474   633 (446)  C ce120109f1   (0)  1020   861 *
 Unused pair: ad030109r1 cb070109f1  -7.2   0
LLR breakdown: discreps: -0.7 (<20 part: -0.7 (#=7), >20:0.0 (#=0); in HQ: 0.0, out HQ -0.7), match: 3.9  trail: -25.2  total: -22.0  149  2.23 1.68 0.00  ad030109r1      455   633 (446)  C cb070109f1   (0)  1035   854 *
 Unused pair: ad030109r1 bc050109r1  -26.9   0
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=1), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 0.8  trail: -22.2  lead: -16.6  total: -38.2   31  2.78 0.00 0.00  ad030109r1      598   633 (446)  C bc050109r1   (913)   192   157 *
 Unused pair: ad030109r1 ba040109r1  -9.0   3
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=11), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 1.1  trail: -25.2  lead: 0.0  total: -24.1   48  4.26 7.45 0.00  ad030109r1      540   633 (446)  C ba040109r1   (28)  1046   946  
 Unused pair: bc050109r1 dg030109r1  -13.5   1
LLR breakdown: discreps: -0.5 (<20 part: -0.5 (#=5), >20:0.0 (#=0); in HQ: -0.3, out HQ -0.2), match: 3.1  trail: -16.6  lead: 0.0  total: -14.0  115  2.11 0.00 1.41  bc050109r1       51   192 (913)    dg030109r1      856   995 (63) *
 Unused pair: bc050109r1 db050109r1  -13.5   2
LLR breakdown: discreps: -0.5 (<20 part: -0.5 (#=5), >20:0.0 (#=0); in HQ: -0.5, out HQ 0.0), match: 3.1  trail: -16.6  lead: 0.0  total: -14.0  115  2.11 0.00 1.41  bc050109r1       51   192 (913)    db050109r1      173   312 (752) *
 Unused pair: bc050109r1 da100109r1  -13.5   0
LLR breakdown: discreps: -0.5 (<20 part: -0.5 (#=5), >20:0.0 (#=0); in HQ: -0.5, out HQ 0.0), match: 3.1  trail: -16.6  lead: 0.0  total: -14.0  115  2.11 0.00 1.41  bc050109r1       51   192 (913)    da100109r1      149   288 (728) *
 Unused pair: bc050109r1 ce120109f1  -13.5   0
LLR breakdown: discreps: -0.5 (<20 part: -0.5 (#=5), >20:0.0 (#=0); in HQ: -0.5, out HQ 0.0), match: 3.1  trail: -16.6  lead: 0.0  total: -14.0  115  2.11 0.00 1.41  bc050109r1       51   192 (913)    ce120109f1      757   896 (124) *
 Unused pair: bc050109r1 bg020109f1  -13.5   1
LLR breakdown: discreps: -0.5 (<20 part: -0.5 (#=5), >20:0.0 (#=0); in HQ: -0.5, out HQ 0.0), match: 3.1  trail: -16.6  lead: 0.0  total: -14.0  115  2.11 0.00 1.41  bc050109r1       51   192 (913)    bg020109f1       34   173 (878) *
 Unused pair: bc050109r1 be050109f1  -13.5   2
LLR breakdown: discreps: -0.5 (<20 part: -0.5 (#=5), >20:0.0 (#=0); in HQ: -0.5, out HQ 0.0), match: 3.1  trail: -16.6  lead: 0.0  total: -14.0  115  2.11 0.00 1.41  bc050109r1       51   192 (913)    be050109f1      529   668 (422) *
 Unused pair: bc050109r1 bc060109r1  -13.5   2
LLR breakdown: discreps: -0.5 (<20 part: -0.5 (#=5), >20:0.0 (#=0); in HQ: -0.5, out HQ 0.0), match: 3.1  trail: -16.6  lead: 0.0  total: -14.0  115  2.11 0.00 1.41  bc050109r1       51   192 (913)    bc060109r1      194   333 (753) *
 Unused pair: ae090109r1 ed060109r1  3.4   0
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=5), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 3.5  trail: 0.0  lead: 0.0  total: 3.3  146  3.09 0.00 0.00  ae090109r1       48   209 (878)  C ed060109r1   (867)   209    48 *
 Unused pair: ae090109r1 dc110109f1  -9.7   1
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=5), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 5.9  trail: -23.7  lead: 0.0  total: -18.0  246  1.86 0.00 0.00  ae090109r1       48   316 (771)  C dc110109f1   (465)   545   277 *
 Unused pair: ae090109r1 cd060109r1  -9.7   0
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=5), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 5.9  trail: -23.7  lead: 0.0  total: -18.0  246  1.86 0.00 0.00  ae090109r1       48   316 (771)    cd060109r1       65   333 (751) *
 Unused pair: ae090109r1 ca020109r1  -2.8   0
LLR breakdown: discreps: -0.6 (<20 part: -0.6 (#=9), >20:0.0 (#=0); in HQ: -0.6, out HQ 0.0), match: 5.8  trail: -8.6  lead: 0.0  total: -3.4  234  3.35 0.00 0.00  ae090109r1       48   316 (771)  C ca020109r1   (781)   321    53 *
 Unused pair: ae090109r1 ca010109r1  3.8   0
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=5), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 3.8  trail: 0.0  lead: 0.0  total: 3.6  159  2.84 0.00 0.00  ae090109r1       48   223 (864)  C ca010109r1   (823)   220    45 *
 Unused pair: ae090109r1 ca010109f1  3.8   0
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=5), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 3.8  trail: 0.0  lead: 0.0  total: 3.6  159  2.84 0.00 0.00  ae090109r1       48   223 (864)    ca010109f1      549   724 (309) *
 Unused pair: ae090109r1 bd030109f1  -10.1   1
LLR breakdown: discreps: -1.1 (<20 part: -1.1 (#=12), >20:0.0 (#=0); in HQ: -1.1, out HQ 0.0), match: 5.7  trail: -23.7  lead: 0.0  total: -19.1  222  4.10 0.00 0.37  ae090109r1       49   316 (771)    bd030109f1       27   293 (861) *
 Unused pair: ae090109r1 ag010109f1  -9.7   0
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=5), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 5.9  trail: -23.7  lead: 0.0  total: -18.0  246  1.86 0.00 0.00  ae090109r1       48   316 (771)    ag010109f1      380   648 (383) *
 Unused pair: ae090109r1 af110109r1  -9.7   0
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=5), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 5.9  trail: -23.7  lead: 0.0  total: -18.0  246  1.86 0.00 0.00  ae090109r1       48   316 (771)  C af110109r1   (463)   612   344 *
Chimeric Unused pair: bd050109f1 bd050109r1  1.7   5
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=12), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 0.0  trail: 0.0  lead: 0.0  total: 0.0   38 10.23 2.27 1.14  bd050109f1      936  1023 (95)  C bd050109r1   (14)  1081   993  
 Unused pair: bc020109r1 ed090109r1  -7.8   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 2.0  trail: -9.9  lead: 0.0  total: -7.9   83  0.00 0.00 0.00  bc020109r1      463   552 (568)    ed090109r1       43   132 (891) *
 Unused pair: bc020109r1 ch050109r1  -8.4   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 1.5  trail: -9.9  lead: 0.0  total: -8.4   61  0.00 0.00 0.00  bc020109r1      487   552 (568)    ch050109r1      163   228 (791) *
 Unused pair: bc020109r1 ce030109r1  -6.7   1
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=10), >20:0.0 (#=0); in HQ: 0.0, out HQ -0.2), match: 3.3  trail: -9.9  total: -6.8  118  5.77 0.64 0.00  bc020109r1      397   552 (568)  C ce030109r1   (0)  1054   898 *
 Unused pair: ca040109r1 ed110109r1  1.3   1
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=3), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 1.4  trail: 0.0  lead: 0.0  total: 1.4   45  0.00 0.00 4.55  ca040109r1      970  1035 (3)    ed110109r1       49   111 (896)  
 Unused pair: ch080109r1 ed110109r1  1.1   2
LLR breakdown: discreps: -0.3 (<20 part: -0.3 (#=3), >20:0.0 (#=0); in HQ: 0.0, out HQ -0.3), match: 1.3  lead: 0.0  total: 1.0   41  0.00 0.00 4.92  ch080109r1      966  1026 (0)    ed110109r1       49   106 (901)  
 Unused pair: cd070109r1 ed110109r1  1.6   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 1.7  trail: 0.0  lead: 0.0  total: 1.7   71  0.00 0.00 0.00  cd070109r1       46   122 (924)  C ed110109r1   (882)   125    49 *
 Unused pair: ae030109r1 ed110109r1  6.1   0
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=13), >20:0.0 (#=0); in HQ: 0.0, out HQ -0.1), match: 5.5  trail: 0.0  lead: 0.0  total: 5.4  216  1.38 0.35 2.77  ae030109r1      751  1039 (44)    ed110109r1       49   330 (677) *
 Unused pair: da010109r1 ed110109r1  6.4   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 6.5  trail: 0.0  lead: 0.0  total: 6.5  275  0.00 0.00 0.00  da010109r1       45   336 (688)  C ed110109r1   (667)   340    49 *
 Unused pair: da040109r1 ed110109r1  9.2   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=3), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 9.2  lead: 0.0  total: 9.2  390  0.72 0.00 0.00  da040109r1      624  1041 (0)    ed110109r1       49   466 (541) *
 Unused pair: ed070109r1 ed110109r1  9.7   1
LLR breakdown: discreps: -0.3 (<20 part: -0.3 (#=5), >20:0.0 (#=0); in HQ: 0.0, out HQ -0.3), match: 9.8  trail: -0.1  lead: 0.0  total: 9.4  414  0.89 0.00 0.22  ed070109r1      599  1045 (5)    ed110109r1       49   494 (513) *
 Unused pair: ce020109f1 ed110109r1  -6.0   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 10.9  trail: -16.9  lead: 0.0  total: -6.0  474  0.00 0.00 0.00  ce020109f1      510   999 (40)    ed110109r1       49   538 (469) *
 Unused pair: ed110109f1 ed110109r1  10.1   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=2), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 10.9  trail: 0.0  lead: 0.0  total: 10.9  481  0.00 0.20 0.20  ed110109f1       10   514 (498)  C ed110109r1   (454)   553    49 *
 Unused pair: bb110109r1 ed110109r1  -6.0   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 10.9  trail: -16.9  lead: 0.0  total: -6.0  474  0.00 0.00 0.00  bb110109r1      410   899 (140)    ed110109r1       49   538 (469) *
 Unused pair: ad080109r1 ed110109r1  -6.0   1
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 10.9  trail: 0.0  lead: -16.9  total: -6.0  474  0.00 0.00 0.00  ad080109r1      289   778 (336)  C ed110109r1   (469)   538    49 *
 Unused pair: dd060109f1 ed110109r1  -6.0   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 10.9  trail: -16.9  lead: 0.0  total: -6.0  474  0.00 0.00 0.00  dd060109f1      307   796 (277)    ed110109r1       49   538 (469) *
 Unused pair: ea040109r1 ed110109r1  -6.0   1
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 10.9  trail: -16.9  lead: 0.0  total: -6.0  474  0.00 0.00 0.00  ea040109r1      246   735 (303)    ed110109r1       49   538 (469) *
 Unused pair: cf050109f1 ed110109r1  -6.0   1
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 10.9  trail: 0.0  lead: -16.9  total: -6.0  474  0.00 0.00 0.00  cf050109f1      329   818 (230)  C ed110109r1   (469)   538    49 *
 Unused pair: ce030109f1 ed110109r1  -6.1   0
LLR breakdown: discreps: -1.5 (<20 part: -1.5 (#=7), >20:0.0 (#=0); in HQ: -1.3, out HQ -0.2), match: 10.8  trail: 0.0  lead: -16.9  total: -7.6  454  1.43 0.00 0.00  ce030109f1      402   891 (166)  C ed110109r1   (469)   538    49 *
 Unused pair: dd060109r1 ed110109r1  -6.0   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=1), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 10.9  trail: 0.0  lead: -16.9  total: -6.0  473  0.20 0.00 0.00  dd060109r1      475   964 (130)  C ed110109r1   (469)   538    49 *
 Unused pair: bh040109f1 ed110109r1  -6.0   1
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=2), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 10.9  trail: -16.9  lead: 0.0  total: -6.2  468  0.41 0.00 0.00  bh040109f1       79   568 (496)    ed110109r1       49   538 (469) *
 Unused pair: ed110109r1 eh040109r1  4.3   4
LLR breakdown: discreps: -0.5 (<20 part: -0.5 (#=17), >20:0.0 (#=0); in HQ: 0.0, out HQ -0.5), match: 3.7  trail: 0.0  lead: 0.0  total: 3.2  132  2.48 5.94 0.00  ed110109r1       49   250 (757)    eh040109r1      830  1043 (4) *
 Unused pair: ed110109r1 eh040109f1  -6.0   0
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=5), >20:0.0 (#=0); in HQ: 0.0, out HQ -0.1), match: 10.8  trail: -16.9  lead: 0.0  total: -6.2  457  0.61 0.41 0.00  ed110109r1       49   538 (469)  C eh040109f1   (43)  1006   515 *
 Unused pair: ed110109r1 eg030109r1  -6.0   1
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 10.9  trail: -16.9  lead: 0.0  total: -6.0  474  0.00 0.00 0.00  ed110109r1       49   538 (469)  C eg030109r1   (231)   806   317 *
 Unused pair: ed110109r1 eg020109f1  -11.6   2
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=2), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 6.5  trail: -16.9  lead: 0.0  total: -10.4  277  0.00 0.68 0.00  ed110109r1      246   538 (469)    eg020109f1       27   321 (698) *
 Unused pair: ed110109r1 ef110109f1  -14.4   1
LLR breakdown: discreps: -0.3 (<20 part: -0.3 (#=2), >20:0.0 (#=0); in HQ: -0.2, out HQ -0.1), match: 2.5  trail: -16.9  total: -14.7  100  0.90 0.90 0.00  ed110109r1      428   538 (469)  C ef110109f1   (0)  1040   929 *
 Unused pair: ed110109r1 ee100109r1  -10.5   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 6.3  trail: -16.9  lead: 0.0  total: -10.6  277  0.00 0.00 0.00  ed110109r1      255   538 (469)    ee100109r1       46   329 (701) *
 Unused pair: ad020109f1 ed110109r1  -7.4   0
LLR breakdown: discreps: -2.1 (<20 part: -2.1 (#=14), >20:0.0 (#=0); in HQ: -0.2, out HQ -1.9), match: 10.5  trail: -16.9  lead: 0.0  total: -8.5  432  2.87 0.00 0.00  ad020109f1       47   533 (544)    ed110109r1       52   538 (469) *
 Unused pair: de010109r1 ed110109r1  -9.9   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 10.3  trail: -16.9  lead: -3.5  total: -10.1  449  0.00 0.00 0.00  de010109r1       48   510 (507)    ed110109r1       76   538 (469) *
 Unused pair: ce110109f1 ed110109r1  -8.2   1
LLR breakdown: discreps: -2.6 (<20 part: 0.0 (#=0), >20:-2.6 (#=1); in HQ: -2.6, out HQ 0.0), match: 9.9  trail: -16.9  lead: 0.0  total: -9.6  426  0.00 0.23 0.00  ce110109f1       24   467 (554)    ed110109r1       94   538 (469) *
 Unused pair: af090109r1 ed110109r1  -9.6   3
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=31), >20:0.0 (#=0); in HQ: 0.0, out HQ -0.1), match: 5.7  trail: 0.0  lead: -16.9  total: -11.3  237  6.42 0.00 2.23  af090109r1      656  1013 (90)  C ed110109r1   (469)   538   189 *
 Unused pair: bd060109f1 ed110109r1  4.8   2
LLR breakdown: discreps: -1.3 (<20 part: -1.3 (#=23), >20:0.0 (#=0); in HQ: -1.1, out HQ -0.2), match: 4.1  trail: 0.0  lead: -16.9  total: -14.1  161  4.28 0.39 4.28  bd060109f1      778  1034 (77)  C ed110109r1   (469)   538   292 *
 Unused pair: ag110109r1 ed110109r1  -11.8   1
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=12), >20:0.0 (#=0); in HQ: 0.0, out HQ -0.2), match: 4.7  trail: 0.0  lead: -16.9  total: -12.4  189  2.48 0.00 2.48  ag110109r1      780  1021 (38)  C ed110109r1   (469)   538   303  
 Unused pair: ag110109r1 eb060109r1  -14.6   2
LLR breakdown: discreps: -0.3 (<20 part: -0.3 (#=3), >20:0.0 (#=0); in HQ: -0.3, out HQ 0.0), match: 2.4  trail: -17.1  lead: 0.0  total: -15.0   99  2.68 0.00 0.00  ag110109r1       62   173 (886)    eb060109r1       73   184 (876) *
 Unused pair: eb060109r1 eg090109r1  1.4   0
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=2), >20:0.0 (#=0); in HQ: -0.1, out HQ 0.0), match: 1.8  trail: 0.0  lead: 0.0  total: 1.7   71  0.00 0.00 2.41  eb060109r1       46   128 (932)  C eg090109r1   (904)   126    46 *
 Unused pair: eb060109r1 eg020109f1  -7.4   1
LLR breakdown: discreps: -0.5 (<20 part: -0.5 (#=6), >20:0.0 (#=0); in HQ: 0.0, out HQ -0.5), match: 1.9  trail: -9.6  total: -8.2   62  2.27 4.55 0.00  eb060109r1       97   184 (876)  C eg020109f1   (0)  1019   928  
 Unused pair: eb060109r1 ef110109f1  -14.4   1
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=2), >20:0.0 (#=0); in HQ: -0.1, out HQ 0.0), match: 3.1  trail: -17.1  lead: 0.0  total: -14.1  124  0.00 0.00 1.44  eb060109r1       46   184 (876)    ef110109f1      186   322 (718) *
 Unused pair: eb060109r1 ef090109f1  -14.4   1
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=2), >20:0.0 (#=0); in HQ: -0.1, out HQ 0.0), match: 3.1  trail: -17.1  lead: 0.0  total: -14.1  124  0.00 0.00 1.44  eb060109r1       46   184 (876)  C ef090109f1   (523)   511   375 *
 Unused pair: eb060109r1 ee100109r1  -15.0   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=5), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 1.6  trail: -17.1  total: -15.5   75  4.26 1.06 0.00  eb060109r1       91   184 (876)  C ee100109r1   (0)  1030   936 *
 Unused pair: eb060109r1 ed070109f1  0.0   1
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=4), >20:0.0 (#=0); in HQ: -0.1, out HQ -0.1), match: 3.0  trail: -2.7  lead: 0.0  total: 0.1  121  1.44 0.72 0.72  eb060109r1       46   184 (876)    ed070109f1      891  1029 (29) *
 Unused pair: de050109f1 ed110109r1  -13.2   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=1), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 3.7  trail: -16.9  lead: 0.0  total: -13.2  162  0.60 0.00 0.00  de050109f1       21   187 (864)    ed110109r1      372   538 (469) *
 Unused pair: de050109f1 eb060109r1  -14.4   0
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=2), >20:0.0 (#=0); in HQ: -0.1, out HQ 0.0), match: 3.1  trail: 0.0  lead: -17.1  total: -14.1  124  0.00 1.46 0.00  de050109f1      794   930 (121)  C eb060109r1   (876)   184    46 *
 Unused pair: cg020109f1 ed110109r1  -13.6   0
LLR breakdown: discreps: -1.4 (<20 part: -1.4 (#=3), >20:0.0 (#=0); in HQ: -1.4, out HQ 0.0), match: 3.4  trail: -16.9  lead: 0.0  total: -14.9  149  1.27 0.64 0.00  cg020109f1       20   176 (830)    ed110109r1      381   538 (469) *
 Unused pair: cg020109f1 eb060109r1  -14.4   1
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=2), >20:0.0 (#=0); in HQ: -0.1, out HQ 0.0), match: 3.1  trail: 0.0  lead: -17.1  total: -14.1  124  0.00 1.46 0.00  cg020109f1      783   919 (87)  C eb060109r1   (876)   184    46 *
 Unused pair: cd030109r1 eb060109r1  -14.4   0
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=2), >20:0.0 (#=0); in HQ: -0.1, out HQ 0.0), match: 3.1  trail: 0.0  lead: -17.1  total: -14.1  124  0.00 1.46 0.00  cd030109r1      634   770 (261)  C eb060109r1   (876)   184    46 *
 Unused pair: ce020109r1 eb060109r1  -14.4   1
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=2), >20:0.0 (#=0); in HQ: -0.1, out HQ 0.0), match: 3.1  trail: -17.1  lead: 0.0  total: -14.1  124  0.00 1.46 0.00  ce020109r1      296   432 (617)    eb060109r1       46   184 (876) *
 Unused pair: cf040109r1 eb060109r1  -14.4   0
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=2), >20:0.0 (#=0); in HQ: -0.1, out HQ 0.0), match: 3.1  trail: 0.0  lead: -17.1  total: -14.1  124  0.00 1.46 0.00  cf040109r1      612   748 (297)  C eb060109r1   (876)   184    46 *
 Unused pair: bb090109r1 eb060109r1  -14.4   1
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=2), >20:0.0 (#=0); in HQ: -0.1, out HQ 0.0), match: 3.1  trail: 0.0  lead: -17.1  total: -14.1  124  0.00 1.46 0.00  bb090109r1      612   748 (305)  C eb060109r1   (876)   184    46 *
 Unused pair: cc030109r1 eb060109r1  -14.4   2
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=2), >20:0.0 (#=0); in HQ: -0.1, out HQ 0.0), match: 3.1  trail: -17.1  lead: 0.0  total: -14.1  124  0.00 1.46 0.00  cc030109r1      309   445 (607)    eb060109r1       46   184 (876) *
 Unused pair: cc030109r1 ce020109r1  -18.6   1
LLR breakdown: discreps: -41.4 (<20 part: -0.7 (#=7), >20:-40.7 (#=11); in HQ: -40.7, out HQ -0.7), match: 22.0  trail: 0.0  lead: 0.0  total: -19.4  948  0.29 0.10 1.34  cc030109r1        3  1048 (4)    ce020109r1        2  1034 (15) *
 Unused pair: ad020109r1 eb060109r1  -7.2   0
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=2), >20:0.0 (#=0); in HQ: -0.1, out HQ 0.0), match: 3.1  trail: 0.0  lead: -10.0  total: -7.0  124  0.00 1.46 0.00  ad020109r1      566   702 (369)  C eb060109r1   (876)   184    46 *
 Unused pair: cf060109r1 eb060109r1  -14.4   0
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=2), >20:0.0 (#=0); in HQ: -0.1, out HQ 0.0), match: 3.1  trail: 0.0  lead: -17.1  total: -14.1  124  0.00 1.46 0.00  cf060109r1      510   646 (387)  C eb060109r1   (876)   184    46 *
 Unused pair: df040109r1 eb060109r1  -14.4   2
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=2), >20:0.0 (#=0); in HQ: -0.1, out HQ 0.0), match: 3.1  trail: -17.1  lead: 0.0  total: -14.1  124  0.00 1.46 0.00  df040109r1      422   558 (499)    eb060109r1       46   184 (876) *
 Unused pair: ch080109f1 eb060109r1  -14.4   2
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=2), >20:0.0 (#=0); in HQ: -0.1, out HQ 0.0), match: 3.1  trail: -17.1  lead: 0.0  total: -14.1  124  0.00 1.46 0.00  ch080109f1      503   639 (397)    eb060109r1       46   184 (876) *
 Unused pair: be030109r1 eb060109r1  -14.5   1
LLR breakdown: discreps: -1.2 (<20 part: -1.2 (#=8), >20:0.0 (#=0); in HQ: -1.2, out HQ 0.0), match: 2.9  trail: 0.0  lead: -17.1  total: -15.4  106  4.38 1.46 0.00  be030109r1      370   506 (650)  C eb060109r1   (876)   184    46 *
 Unused pair: bh110109f1 eb060109r1  -14.4   1
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=2), >20:0.0 (#=0); in HQ: -0.1, out HQ 0.0), match: 3.1  trail: 0.0  lead: -17.1  total: -14.1  124  0.00 1.46 0.00  bh110109f1      360   496 (538)  C eb060109r1   (876)   184    46 *
 Unused pair: bb110109f1 eb060109r1  -14.4   1
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=2), >20:0.0 (#=0); in HQ: -0.1, out HQ 0.0), match: 3.1  trail: -17.1  lead: 0.0  total: -14.1  124  0.00 1.46 0.00  bb110109f1      602   738 (304)    eb060109r1       46   184 (876) *
 Unused pair: ce110109r1 eb060109r1  -14.4   1
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=2), >20:0.0 (#=0); in HQ: -0.1, out HQ 0.0), match: 3.1  trail: -17.1  lead: 0.0  total: -14.1  124  0.00 1.46 0.00  ce110109r1      623   759 (264)    eb060109r1       46   184 (876) *
 Unused pair: de010109f1 eb060109r1  -14.4   2
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=2), >20:0.0 (#=0); in HQ: -0.1, out HQ 0.0), match: 3.1  trail: -17.1  lead: 0.0  total: -14.1  124  0.00 1.46 0.00  de010109f1      694   830 (207)    eb060109r1       46   184 (876) *
 Unused pair: ba060109r1 eb060109r1  -14.4   1
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=2), >20:0.0 (#=0); in HQ: -0.1, out HQ 0.0), match: 3.1  trail: 0.0  lead: -17.1  total: -14.1  124  0.00 1.46 0.00  ba060109r1      105   241 (819)  C eb060109r1   (876)   184    46 *
 Unused pair: ea040109f1 eb060109r1  2.4   0
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=2), >20:0.0 (#=0); in HQ: -0.1, out HQ 0.0), match: 3.1  trail: -0.8  lead: 0.0  total: 2.2  124  0.00 1.46 0.00  ea040109f1      866  1002 (41)    eb060109r1       46   184 (876) *
 Unused pair: eb060109f1 eb060109r1  2.1   2
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=6), >20:0.0 (#=0); in HQ: -0.1, out HQ 0.0), match: 3.0  trail: 0.0  lead: 0.0  total: 2.9  125  1.33 1.33 1.33  eb060109f1       12   161 (902)  C eb060109r1   (863)   197    48 *
 Unused pair: da040109f1 eb060109r1  2.5   2
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=4), >20:0.0 (#=0); in HQ: -0.1, out HQ -0.1), match: 2.9  trail: -0.4  lead: 0.0  total: 2.3  115  1.49 1.49 0.00  da040109f1      889  1022 (25)    eb060109r1       46   181 (879) *
 Unused pair: ce060109f1 eb060109r1  0.7   0
LLR breakdown: discreps: -0.3 (<20 part: -0.3 (#=4), >20:0.0 (#=0); in HQ: -0.3, out HQ 0.0), match: 1.1  trail: 0.0  lead: 0.0  total: 0.8   34  0.00 5.77 1.92  ce060109f1       22    73 (959)  C eb060109r1   (961)    99    46 *
 Unused pair: dg100109r1 eb060109r1  1.0   0
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=4), >20:0.0 (#=0); in HQ: 0.0, out HQ -0.2), match: 1.4  lead: 0.0  total: 1.2   43  0.00 4.84 1.61  dg100109r1     1002  1063 (0)    eb060109r1       46   109 (951)  
 Unused pair: ab040109r1 dg010109r1  1.9   0
LLR breakdown: discreps: -0.8 (<20 part: -0.8 (#=8), >20:0.0 (#=0); in HQ: -0.8, out HQ 0.0), match: 2.0  lead: 0.0  total: 1.2   68  8.25 0.00 0.00  ab040109r1       48   144 (964)  C dg010109r1   (860)   141    45  
 Unused pair: cd030109f1 dg010109r1  1.6   0
LLR breakdown: discreps: -0.7 (<20 part: -0.7 (#=5), >20:0.0 (#=0); in HQ: -0.7, out HQ 0.0), match: 1.6  lead: 0.0  total: 0.9   58  6.49 0.00 0.00  cd030109f1       25   101 (945)  C dg010109r1   (880)   121    45  
 Unused pair: df010109f1 dg010109r1  3.4   0
LLR breakdown: discreps: -2.0 (<20 part: -2.0 (#=10), >20:0.0 (#=0); in HQ: -2.0, out HQ 0.0), match: 3.7  lead: 0.0  total: 1.7  130  5.20 0.58 0.00  df010109f1       30   202 (827)  C dg010109r1   (783)   218    45  
 Unused pair: bf070109f1 dg010109r1  4.7   1
LLR breakdown: discreps: -1.3 (<20 part: -1.3 (#=10), >20:0.0 (#=0); in HQ: -1.3, out HQ 0.0), match: 5.2  lead: -0.2  total: 3.7  197  3.69 0.41 0.00  bf070109f1       25   268 (802)  C dg010109r1   (712)   289    45  
 Unused pair: cc060109r1 dg010109r1  4.5   1
LLR breakdown: discreps: -1.2 (<20 part: -1.2 (#=9), >20:0.0 (#=0); in HQ: -1.2, out HQ 0.0), match: 5.1  lead: 0.0  total: 3.9  190  3.39 0.42 0.00  cc060109r1       46   281 (786)  C dg010109r1   (720)   281    45  
 Unused pair: ca120109f1 dg010109r1  4.0   0
LLR breakdown: discreps: -0.8 (<20 part: -0.8 (#=8), >20:0.0 (#=0); in HQ: -0.8, out HQ 0.0), match: 4.1  lead: 0.0  total: 3.3  154  4.15 0.00 0.00  ca120109f1       40   232 (780)  C dg010109r1   (764)   237    45  
 Unused pair: dg010109f1 dg010109r1  7.5   0
LLR breakdown: discreps: -1.2 (<20 part: -1.2 (#=10), >20:0.0 (#=0); in HQ: -1.2, out HQ 0.0), match: 7.7  lead: 0.0  total: 6.5  315  2.47 0.00 0.27  dg010109f1       14   377 (628)  C dg010109r1   (594)   407    45 *
 Unused pair: da070109f1 dg010109r1  2.3   0
LLR breakdown: discreps: -1.9 (<20 part: -1.9 (#=12), >20:0.0 (#=0); in HQ: -1.8, out HQ -0.1), match: 7.6  trail: -5.3  total: 0.4  298  3.10 0.00 0.28  da070109f1      576   930 (95)    dg010109r1       45   398 (603)  
 Unused pair: dg010109r1 dh120109f1  -7.7   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 3.7  trail: -19.7  lead: 0.0  total: -16.0  156  0.00 0.00 0.00  dg010109r1      235   398 (603)    dh120109f1       24   187 (828) *
 Unused pair: dg010109r1 dh110109r1  7.0   0
LLR breakdown: discreps: -1.0 (<20 part: -1.0 (#=14), >20:0.0 (#=0); in HQ: -0.8, out HQ -0.2), match: 7.1  total: 6.1  271  3.32 0.91 0.00  dg010109r1       45   375 (626)    dh110109r1      681  1014 (0)  
 Unused pair: dg010109r1 dh070109f1  4.9   0
LLR breakdown: discreps: -1.0 (<20 part: -1.0 (#=12), >20:0.0 (#=0); in HQ: -0.8, out HQ -0.2), match: 5.1  trail: 0.0  total: 4.1  181  4.22 0.84 0.00  dg010109r1       45   281 (720)    dh070109f1      774  1012 (1)  
 Unused pair: dg010109r1 dh010109r1  6.8   0
LLR breakdown: discreps: -1.0 (<20 part: -1.0 (#=11), >20:0.0 (#=0); in HQ: -0.8, out HQ -0.2), match: 7.0  total: 6.0  274  3.10 0.31 0.00  dg010109r1       45   367 (634)    dh010109r1      660   983 (0)  
 Unused pair: ah100109f1 dg010109r1  -6.6   1
LLR breakdown: discreps: -0.3 (<20 part: -0.3 (#=9), >20:0.0 (#=0); in HQ: -0.2, out HQ -0.1), match: 5.2  trail: -19.7  lead: 0.0  total: -14.8  209  2.38 0.40 0.79  ah100109f1       86   337 (752)    dg010109r1      148   398 (603) *
 Unused pair: da120109f1 dg010109r1  -7.6   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=1), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 4.5  trail: -19.7  lead: 0.0  total: -15.2  185  0.00 0.00 0.50  da120109f1       25   225 (776)    dg010109r1      199   398 (603) *
 Unused pair: df030109f1 dg010109r1  -6.9   2
LLR breakdown: discreps: -0.4 (<20 part: -0.4 (#=7), >20:0.0 (#=0); in HQ: 0.0, out HQ -0.4), match: 4.4  trail: 0.0  lead: -19.7  total: -15.7  164  1.46 0.00 1.95  df030109f1      832  1036 (4)  C dg010109r1   (603)   398   198 *
 Unused pair: cb100109r1 dg010109r1  -9.3   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 2.1  trail: 0.0  lead: -19.7  total: -17.6   88  0.00 0.00 0.00  cb100109r1      926  1018 (1)  C dg010109r1   (603)   398   306 *
 Unused pair: aa110109r1 ae070109r1  -10.5   0
LLR breakdown: discreps: -0.3 (<20 part: -0.3 (#=4), >20:0.0 (#=0); in HQ: -0.3, out HQ 0.0), match: 1.0  trail: -13.2  lead: 0.0  total: -12.5   32  8.33 0.00 0.00  aa110109r1      309   356 (678)    ae070109r1       47    94 (1000) *
 Unused pair: ae070109r1 eg060109f1  -10.5   0
LLR breakdown: discreps: -0.3 (<20 part: -0.3 (#=4), >20:0.0 (#=0); in HQ: -0.3, out HQ 0.0), match: 1.0  trail: -13.2  lead: 0.0  total: -12.5   33  8.33 0.00 0.00  ae070109r1       47    94 (1000)  C eg060109f1   (396)   643   596 *
 Unused pair: ae070109r1 ec110109r1  -10.5   0
LLR breakdown: discreps: -0.3 (<20 part: -0.3 (#=4), >20:0.0 (#=0); in HQ: -0.3, out HQ 0.0), match: 1.0  trail: -13.2  lead: 0.0  total: -12.5   33  8.33 0.00 0.00  ae070109r1       47    94 (1000)  C ec110109r1   (399)   604   557 *
 Unused pair: ae070109r1 dh120109r1  -10.5   0
LLR breakdown: discreps: -0.3 (<20 part: -0.3 (#=4), >20:0.0 (#=0); in HQ: -0.3, out HQ 0.0), match: 1.0  trail: -13.2  lead: 0.0  total: -12.5   33  8.33 0.00 0.00  ae070109r1       47    94 (1000)  C dh120109r1   (610)   405   358 *
 Unused pair: ae070109r1 dg120109f1  -10.5   1
LLR breakdown: discreps: -0.3 (<20 part: -0.3 (#=4), >20:0.0 (#=0); in HQ: -0.3, out HQ 0.0), match: 1.0  trail: -13.2  lead: 0.0  total: -12.5   33  8.33 0.00 0.00  ae070109r1       47    94 (1000)  C dg120109f1   (140)   886   839 *
 Unused pair: ae070109r1 dg090109r1  -10.5   0
LLR breakdown: discreps: -0.3 (<20 part: -0.3 (#=4), >20:0.0 (#=0); in HQ: -0.3, out HQ 0.0), match: 1.0  trail: -13.2  lead: 0.0  total: -12.5   33  8.33 0.00 0.00  ae070109r1       47    94 (1000)    dg090109r1      309   356 (687) *
 Unused pair: ae070109r1 de080109f1  -8.9   0
LLR breakdown: discreps: -0.3 (<20 part: -0.3 (#=4), >20:0.0 (#=0); in HQ: -0.3, out HQ 0.0), match: 1.0  trail: -9.9  lead: 0.0  total: -9.2   33  8.33 0.00 0.00  ae070109r1       47    94 (1000)  C de080109f1   (926)   115    68 *
 Unused pair: ae070109r1 de070109f1  -10.5   1
LLR breakdown: discreps: -0.3 (<20 part: -0.3 (#=4), >20:0.0 (#=0); in HQ: -0.3, out HQ 0.0), match: 1.0  trail: -13.2  lead: 0.0  total: -12.5   33  8.33 0.00 0.00  ae070109r1       47    94 (1000)    de070109f1      240   287 (758) *
 Unused pair: ae070109r1 db110109r1  -10.5   0
LLR breakdown: discreps: -0.3 (<20 part: -0.3 (#=4), >20:0.0 (#=0); in HQ: -0.3, out HQ 0.0), match: 1.0  trail: -13.2  lead: 0.0  total: -12.5   33  8.33 0.00 0.00  ae070109r1       47    94 (1000)  C db110109r1   (114)   889   842 *
 Unused pair: ae070109r1 db060109r1  -10.5   0
LLR breakdown: discreps: -0.3 (<20 part: -0.3 (#=4), >20:0.0 (#=0); in HQ: -0.3, out HQ 0.0), match: 1.0  trail: -13.2  lead: 0.0  total: -12.5   33  8.33 0.00 0.00  ae070109r1       47    94 (1000)  C db060109r1   (598)   444   397 *
 Unused pair: ae070109r1 ch100109f1  -8.9   0
LLR breakdown: discreps: -0.3 (<20 part: -0.3 (#=4), >20:0.0 (#=0); in HQ: -0.3, out HQ 0.0), match: 1.0  trail: -9.9  lead: 0.0  total: -9.2   33  8.33 0.00 0.00  ae070109r1       47    94 (1000)  C ch100109f1   (921)   117    70 *
 Unused pair: ae070109r1 ch020109r1  -10.5   0
LLR breakdown: discreps: -0.3 (<20 part: -0.3 (#=4), >20:0.0 (#=0); in HQ: -0.3, out HQ 0.0), match: 1.0  trail: -13.2  lead: 0.0  total: -12.5   33  8.33 0.00 0.00  ae070109r1       47    94 (1000)  C ch020109r1   (74)   943   896 *
 Unused pair: ae070109r1 cf080109f1  -10.5   0
LLR breakdown: discreps: -0.3 (<20 part: -0.3 (#=4), >20:0.0 (#=0); in HQ: -0.3, out HQ 0.0), match: 1.0  trail: -13.2  lead: 0.0  total: -12.5   33  8.33 0.00 0.00  ae070109r1       47    94 (1000)  C cf080109f1   (224)   839   792 *
 Unused pair: ae070109r1 cf020109r1  -10.5   0
LLR breakdown: discreps: -0.3 (<20 part: -0.3 (#=4), >20:0.0 (#=0); in HQ: -0.3, out HQ 0.0), match: 1.0  trail: -13.2  lead: 0.0  total: -12.5   33  8.33 0.00 0.00  ae070109r1       47    94 (1000)    cf020109r1      370   417 (629) *
 Unused pair: ae070109r1 ca030109r1  -4.2   0
LLR breakdown: discreps: -0.3 (<20 part: -0.3 (#=4), >20:0.0 (#=0); in HQ: -0.3, out HQ 0.0), match: 1.0  trail: -5.2  lead: 0.0  total: -4.5   33  8.33 0.00 0.00  ae070109r1       47    94 (1000)  C ca030109r1   (941)    98    51 *
 Unused pair: ae070109r1 be080109r1  -10.5   0
LLR breakdown: discreps: -0.3 (<20 part: -0.3 (#=4), >20:0.0 (#=0); in HQ: -0.3, out HQ 0.0), match: 1.0  trail: -13.2  lead: 0.0  total: -12.5   33  8.33 0.00 0.00  ae070109r1       47    94 (1000)  C be080109r1   (922)   157   110 *
 Unused pair: ae070109r1 bb120109f1  -10.5   0
LLR breakdown: discreps: -0.3 (<20 part: -0.3 (#=4), >20:0.0 (#=0); in HQ: -0.3, out HQ 0.0), match: 1.0  trail: -13.2  lead: 0.0  total: -12.5   33  8.33 0.00 0.00  ae070109r1       47    94 (1000)  C bb120109f1   (135)   891   844 *
 Unused pair: ae070109r1 ba080109f1  -8.9   1
LLR breakdown: discreps: -0.4 (<20 part: -0.4 (#=5), >20:0.0 (#=0); in HQ: -0.4, out HQ 0.0), match: 1.0  trail: -9.9  lead: 0.0  total: -9.3   30 10.42 0.00 0.00  ae070109r1       47    94 (1000)  C ba080109f1   (959)   106    59 *
Chimeric Unused pair: ab100109f1 ca060109r1  1.6   1
LLR breakdown: discreps: -2.8 (<20 part: -2.8 (#=16), >20:0.0 (#=0); in HQ: -1.1, out HQ -1.7), match: 2.0  trail: 0.0  total: -0.8   38 10.68 4.85 0.00  ab100109f1       87   189 (917)    ca060109r1       93   200 (861)  
 Unused pair: ab100109f1 ab100109r1  1.7   0
LLR breakdown: discreps: -0.4 (<20 part: -0.4 (#=7), >20:0.0 (#=0); in HQ: -0.2, out HQ -0.2), match: 2.1  trail: 0.0  total: 1.7   70  6.80 0.00 0.00  ab100109f1       87   189 (917)  C ab100109r1   (962)   152    50  
Chimeric Unused pair: ca060109r1 eg010109f1  5.3   3
LLR breakdown: discreps: -14.7 (<20 part: -14.7 (#=83), >20:0.0 (#=0); in HQ: -1.1, out HQ -13.6), match: 6.7  trail: -2.2  lead: 0.0  total: -10.2   86 18.44 0.00 3.12  ca060109r1       48   432 (629)  C eg010109f1   (429)   603   231  
Chimeric Unused pair: ca060109r1 ef070109f1  5.3   5
LLR breakdown: discreps: -14.7 (<20 part: -14.7 (#=83), >20:0.0 (#=0); in HQ: -1.1, out HQ -13.6), match: 6.7  trail: -2.2  lead: 0.0  total: -10.2   85 18.44 0.00 3.12  ca060109r1       48   432 (629)    ef070109f1      257   629 (419)  
Chimeric Unused pair: ca060109r1 ec070109f1  5.2   5
LLR breakdown: discreps: -14.7 (<20 part: -14.7 (#=84), >20:0.0 (#=0); in HQ: -1.1, out HQ -13.6), match: 6.7  trail: -0.9  lead: 0.0  total: -8.9   84 18.96 0.00 2.86  ca060109r1       48   432 (629)    ec070109f1      657  1030 (7) *
Chimeric Unused pair: ca060109r1 ec060109f1  3.5   6
LLR breakdown: discreps: -7.1 (<20 part: -7.1 (#=49), >20:0.0 (#=0); in HQ: -1.1, out HQ -6.0), match: 4.7  trail: -1.9  lead: 0.0  total: -4.3   80 16.41 0.00 2.29  ca060109r1       48   309 (752)  C ec060109f1   (769)   306    51  
Chimeric Unused pair: ca060109r1 ec050109f1  5.3   6
LLR breakdown: discreps: -14.7 (<20 part: -14.7 (#=83), >20:0.0 (#=0); in HQ: -1.1, out HQ -13.6), match: 6.7  trail: -2.2  lead: 0.0  total: -10.2   85 18.44 0.00 3.12  ca060109r1       48   432 (629)    ec050109f1      358   730 (362)  
Chimeric Unused pair: ca060109r1 db120109f1  3.5   4
LLR breakdown: discreps: -6.9 (<20 part: -6.9 (#=47), >20:0.0 (#=0); in HQ: -1.1, out HQ -5.8), match: 4.7  trail: -2.7  lead: 0.0  total: -4.9   86 15.65 0.00 2.29  ca060109r1       48   309 (752)    db120109f1      619   874 (110)  
Chimeric Unused pair: ca060109r1 cf020109f1  5.3   6
LLR breakdown: discreps: -14.7 (<20 part: -14.7 (#=83), >20:0.0 (#=0); in HQ: -1.1, out HQ -13.6), match: 6.7  trail: -2.2  lead: 0.0  total: -10.2   85 18.44 0.00 3.12  ca060109r1       48   432 (629)    cf020109f1      270   642 (401)  
Chimeric Unused pair: ca060109r1 ce010109r1  5.3   4
LLR breakdown: discreps: -14.7 (<20 part: -14.7 (#=83), >20:0.0 (#=0); in HQ: -1.1, out HQ -13.6), match: 6.7  trail: -2.2  lead: 0.0  total: -10.2   86 18.44 0.00 3.12  ca060109r1       48   432 (629)  C ce010109r1   (461)   558   186  
Chimeric Unused pair: ae020109r1 ca060109r1  5.3   4
LLR breakdown: discreps: -14.7 (<20 part: -14.7 (#=84), >20:0.0 (#=0); in HQ: -1.1, out HQ -13.6), match: 6.7  trail: 0.0  lead: -2.2  total: -10.2   59 19.30 3.22 0.00  ae020109r1      536   908 (144)  C ca060109r1   (629)   432    48  
Chimeric Unused pair: ad070109f1 ca060109r1  5.3   6
LLR breakdown: discreps: -14.7 (<20 part: -14.7 (#=83), >20:0.0 (#=0); in HQ: -1.1, out HQ -13.6), match: 6.7  trail: -2.2  lead: 0.0  total: -10.2   62 19.03 3.22 0.00  ad070109f1      193   565 (525)    ca060109r1       48   432 (629)  
Chimeric Unused pair: af080109r1 ca060109r1  2.9   3
LLR breakdown: discreps: -5.8 (<20 part: -5.8 (#=38), >20:0.0 (#=0); in HQ: -1.1, out HQ -4.7), match: 4.2  trail: -1.3  lead: 0.0  total: -2.9   70 14.03 2.71 0.45  af080109r1      728   948 (126)    ca060109r1       48   273 (788)  
Chimeric Unused pair: ad090109f1 ca060109r1  3.0   5
LLR breakdown: discreps: -5.7 (<20 part: -5.7 (#=36), >20:0.0 (#=0); in HQ: -1.1, out HQ -4.6), match: 4.2  trail: 0.0  lead: -0.8  total: -2.3   76 13.64 2.73 0.00  ad090109f1       91   310 (770)  C ca060109r1   (788)   273    48  
 Unused pair: ab100109r1 eg010109f1  -15.7   1
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=5), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 3.5  trail: -19.2  lead: 0.0  total: -15.9  133  3.09 0.00 0.00  ab100109r1       50   211 (903)    eg010109f1      456   617 (415)  
 Unused pair: ab100109r1 ef070109f1  -15.7   0
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=5), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 3.5  trail: -19.2  lead: 0.0  total: -15.9  133  3.09 0.00 0.00  ab100109r1       50   211 (903)  C ef070109f1   (644)   404   243  
 Unused pair: ab100109r1 ec070109f1  -15.7   1
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=5), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 3.5  trail: -19.2  lead: 0.0  total: -15.9  133  3.09 0.00 0.00  ab100109r1       50   211 (903)  C ec070109f1   (233)   804   643  
 Unused pair: ab100109r1 ec060109f1  -15.7   0
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=5), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 3.5  trail: -19.2  lead: 0.0  total: -15.9  133  3.09 0.00 0.00  ab100109r1       50   211 (903)    ec060109f1      159   320 (755)  
 Unused pair: ab100109r1 ec050109f1  -15.7   0
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=5), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 3.5  trail: -19.2  lead: 0.0  total: -15.9  133  3.09 0.00 0.00  ab100109r1       50   211 (903)  C ec050109f1   (587)   505   344  
 Unused pair: ab100109r1 dd080109f1  3.1   1
LLR breakdown: discreps: -0.9 (<20 part: -0.9 (#=13), >20:0.0 (#=0); in HQ: 0.0, out HQ -0.9), match: 3.1  trail: 0.0  lead: 0.0  total: 2.2  102  8.44 0.00 0.00  ab100109r1       50   203 (911)    dd080109f1      783   936 (138) *
 Unused pair: ab100109r1 db120109f1  -15.7   0
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=5), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 3.5  trail: -19.2  lead: 0.0  total: -15.9  133  3.09 0.00 0.00  ab100109r1       50   211 (903)  C db120109f1   (218)   766   605  
 Unused pair: ab100109r1 cf020109f1  -15.7   0
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=5), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 3.5  trail: -19.2  lead: 0.0  total: -15.9  133  3.09 0.00 0.00  ab100109r1       50   211 (903)  C cf020109f1   (626)   417   256  
 Unused pair: ab100109r1 ce010109r1  -15.7   1
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=5), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 3.5  trail: -19.2  lead: 0.0  total: -15.9  133  3.09 0.00 0.00  ab100109r1       50   211 (903)    ce010109r1      411   572 (447)  
 Unused pair: ab100109r1 ah070109r1  2.8   0
LLR breakdown: discreps: -1.3 (<20 part: -1.3 (#=9), >20:0.0 (#=0); in HQ: -1.3, out HQ 0.0), match: 2.9  trail: 0.0  lead: 0.0  total: 1.6   98  6.52 0.00 0.00  ab100109r1       50   187 (927)    ah070109r1      320   457 (696)  
 Unused pair: ab100109r1 af080109r1  -15.7   0
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=5), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 3.5  trail: -19.2  lead: 0.0  total: -15.9  133  3.09 0.00 0.00  ab100109r1       50   211 (903)  C af080109r1   (199)   875   714  
 Unused pair: ab100109r1 ae020109r1  -10.5   0
LLR breakdown: discreps: -0.3 (<20 part: -0.3 (#=6), >20:0.0 (#=0); in HQ: -0.2, out HQ -0.1), match: 3.5  trail: -14.1  lead: 0.0  total: -10.9  130  3.70 0.00 0.00  ab100109r1       50   211 (903)    ae020109r1      761   922 (130)  
 Unused pair: ab100109r1 ad090109f1  -15.7   2
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=5), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 3.5  trail: -19.2  lead: 0.0  total: -15.9  133  3.09 0.00 0.00  ab100109r1       50   211 (903)    ad090109f1      163   324 (756)  
 Unused pair: ab100109r1 ad070109f1  -15.7   0
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=5), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 3.5  trail: -19.2  lead: 0.0  total: -15.9  133  3.09 0.00 0.00  ab100109r1       50   211 (903)  C ad070109f1   (750)   340   179  
 Unused pair: ee080109r1 eh080109r1  -6.5   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 4.5  trail: -20.0  lead: 0.0  total: -15.5  201  0.00 0.00 0.00  ee080109r1       47   250 (795)    eh080109r1      102   305 (738) *
 Unused pair: bc120109r1 ec120109r1  -12.7   0
LLR breakdown: discreps: -0.5 (<20 part: -0.5 (#=6), >20:0.0 (#=0); in HQ: 0.0, out HQ -0.5), match: 2.9  trail: -17.8  lead: 0.0  total: -15.4   81  2.26 2.26 0.00  bc120109r1      144   276 (796)  C ec120109r1   (7)   997   862 *
 Unused pair: bc120109r1 eb090109f1  -10.7   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=5), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 4.9  trail: -17.8  lead: 0.0  total: -12.9  174  1.79 0.00 0.45  bc120109r1       53   276 (796)  C eb090109f1   (328)   710   488 *
 Unused pair: bc120109r1 dc020109r1  -10.7   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=5), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 4.9  trail: -17.8  lead: 0.0  total: -12.9  173  1.79 0.00 0.45  bc120109r1       53   276 (796)    dc020109r1       94   316 (711) *
 Unused pair: bc120109r1 db040109r1  -10.8   1
LLR breakdown: discreps: -1.7 (<20 part: -1.7 (#=14), >20:0.0 (#=0); in HQ: 0.0, out HQ -1.7), match: 4.7  trail: -17.8  lead: -0.3  total: -15.1  142  4.07 2.26 0.00  bc120109r1       56   276 (796)  C db040109r1   (85)  1002   777 *
 Unused pair: bc120109r1 cd020109r1  -10.7   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=5), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 4.9  trail: -17.8  lead: 0.0  total: -12.9  173  1.79 0.00 0.45  bc120109r1       53   276 (796)    cd020109r1      432   654 (374) *
 Unused pair: bc120109r1 ca050109r1  -6.4   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=5), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 4.9  trail: -11.5  lead: 0.0  total: -6.6  174  1.79 0.00 0.45  bc120109r1       53   276 (796)  C ca050109r1   (731)   318    96 *
 Unused pair: bc120109r1 ca050109f1  -10.9   1
LLR breakdown: discreps: -0.6 (<20 part: -0.6 (#=6), >20:0.0 (#=0); in HQ: -0.6, out HQ 0.0), match: 4.8  trail: -17.8  lead: -0.2  total: -13.8  165  1.82 0.00 0.91  bc120109r1       57   276 (796)    ca050109f1       29   246 (807) *
 Unused pair: bc120109r1 bg080109r1  -10.7   1
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=5), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 4.9  trail: -17.8  lead: 0.0  total: -12.9  173  1.79 0.00 0.45  bc120109r1       53   276 (796)    bg080109r1      542   764 (389) *
 Unused pair: bc120109r1 be110109r1  -10.7   1
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=5), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 4.9  trail: -17.8  lead: 0.0  total: -12.9  173  1.79 0.00 0.45  bc120109r1       53   276 (796)    be110109r1      182   404 (663) *

Slack, # used pairs (max_score), unused
 0  3696  (22.5)    89 (10.1)     9058
 1  2999  (22.6)    46 ( 9.7)      814
 2  1065  (21.8)    15 ( 4.8)        7
 3   569  (22.0)     4 ( 5.3)        0
 4   290  (20.5)     4 ( 5.3)        0
 5   155  (21.3)     4 ( 5.3)        0
 6   125  (21.4)     4 ( 5.3)        0
 7    69  (20.7)     0 ( 0.0)        0
 8    40  (20.7)     0 ( 0.0)        0
 9    22  (19.6)     0 ( 0.0)        0
10    22  (15.7)     0 ( 0.0)        0
11    15  (21.6)     0 ( 0.0)        0
12     6  (15.8)     0 ( 0.0)        0
14     1  (18.7)     0 ( 0.0)        0
15     1  ( 1.7)     0 ( 0.0)        0
35     1  ( 0.8)     0 ( 0.0)        0
81     0  ( 0.0)     1 (-99.9)        0
84     0  ( 0.0)     2 (-99.9)        0
85     0  ( 0.0)     4 (-99.9)        0
86     0  ( 0.0)     1 (-99.9)        0
99     0  ( 0.0)   629 ( 1.5)        0

LLR histograms (used, unused pairs): 

   DS Gap         Size      Closest read (Start)   Covers   Read length required
                                                    now?        to cover
Top strand: 
 left -     0        0+
 5628 -  5925      298       ah030109f1   (4702)    No           1224
41546 - 41673      128       ca050109f1   (40587)    No           1087
42687 - 43067      381       df050109r1   (41908)    No           1160
43715 - 43998      284       af030109f1   (43036)    Yes           963
44081 - right        0+      bf060109r1   (43954)    No            126+

Bottom strand: 
 left -     0        0+      ce040109f1   (  75)    Yes            75+
  604 -   780      177       bc050109f1   ( 944)    Yes           341 
10070 - 10092       23       be100109r1   (10119)    Yes            50 
44074 - right        7+

Read/contig alignment summary, by read base; trace qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
56 221225 221225 588340 (100.00)   433  0    0   0   0   0     0 (0.00)    0  9463 (1.61)
51  61482 282707 367115 ( 62.40)   170  0    0   0   0   0     0 (0.00)    0  9463 (2.58)
50  13246 295953 305633 ( 51.95)    53  0    0   0   0   0     0 (0.00)    0  9463 (3.10)
48   3668 299621 292387 ( 49.70)    93  0    0   0   0   0     0 (0.00)    0  9463 (3.24)
47   2506 302127 288719 ( 49.07)    13  0    0   0   0   0     0 (0.00)    0  9463 (3.28)
46   8176 310303 286213 ( 48.65)   171  0    0   0   0   0     0 (0.00)    0  9463 (3.31)
45  13035 323338 278037 ( 47.26)    54  0    0   0   0   0     0 (0.00)    0  9463 (3.40)
44   9585 332923 265002 ( 45.04)    96  0    0   0   0   0     0 (0.00)    0  9463 (3.57)
43  10802 343725 255417 ( 43.41)    87  0    0   0   0   0     0 (0.00)    0  9463 (3.70)
42  19932 363657 244615 ( 41.58)   116  0    0   0   0   1     1 (0.01)    1  9463 (3.87)
41   2147 365804 224683 ( 38.19)    19  0    0   0   0   0     0 (0.00)    1  9462 (4.21)
40  30142 395946 222536 ( 37.82)   428  0    0   0   0   1     1 (0.00)    2  9462 (4.25)
39   1798 397744 192394 ( 32.70)    30  0    0   0   0   0     0 (0.00)    2  9461 (4.92)
38   1005 398749 190596 ( 32.40)    24  0    0   0   0   0     0 (0.00)    2  9461 (4.96)
37   7661 406410 189591 ( 32.22)    69  0    0   0   0   0     0 (0.00)    2  9461 (4.99)
36    823 407233 181930 ( 30.92)    14  0    0   0   0   0     0 (0.00)    2  9461 (5.20)
35   5970 413203 181107 ( 30.78)    67  0    0   0   1   0     1 (0.02)    3  9461 (5.22)
34   5087 418290 175137 ( 29.77)    42  0    0   0   0   1     1 (0.02)    4  9460 (5.40)
33   3460 421750 170050 ( 28.90)    58  0    0   1   0   0     1 (0.03)    5  9459 (5.56)
32   5157 426907 166590 ( 28.32)   285  0    0   0   2   2     4 (0.08)    9  9458 (5.68)
31   2924 429831 161433 ( 27.44)    44  0    0   0   0   0     0 (0.00)    9  9454 (5.86)
30   1559 431390 158509 ( 26.94)    50  0    0   0   0   0     0 (0.00)    9  9454 (5.96)
29  10860 442250 156950 ( 26.68)   264  0    0   1   6   0     7 (0.06)   16  9454 (6.02)
28   2700 444950 146090 ( 24.83)    62  0    0   0   1   0     1 (0.04)   17  9447 (6.47)
27   3676 448626 143390 ( 24.37)   228  0    0   0   4   2     6 (0.16)   23  9446 (6.59)
26   1470 450096 139714 ( 23.75)    75  0    0   3   1   0     4 (0.27)   27  9440 (6.76)
25   8885 458981 138244 ( 23.50)   254  0    0   4   2   1     7 (0.08)   34  9436 (6.83)
24   4673 463654 129359 ( 21.99)   333  0    0   6   5   0    11 (0.24)   45  9429 (7.29)
23   2751 466405 124686 ( 21.19)   351  0    0   3   4   1     8 (0.29)   53  9418 (7.55)
22   3867 470272 121935 ( 20.73)   175  0    0   8   4   2    14 (0.36)   67  9410 (7.72)
21   4021 474293 118068 ( 20.07)   338  0    0  17   3   1    21 (0.52)   88  9396 (7.96)
20   3512 477805 114047 ( 19.38)   311  0    0   5   9   4    18 (0.51)  106  9375 (8.22)
19   6003 483808 110535 ( 18.79)   492  0    0  19  13   5    37 (0.62)  143  9357 (8.47)
18   4808 488616 104532 ( 17.77)   282  0    0  21   8   2    31 (0.64)  174  9320 (8.92)
17   3665 492281  99724 ( 16.95)   300  0    0  28  14   6    48 (1.31)  222  9289 (9.31)
16   4010 496291  96059 ( 16.33)   438  0    0  54  28   5    87 (2.17)  309  9241 (9.62)
15   6645 502936  92049 ( 15.65)   589  0    0  75  24   7   106 (1.60)  415  9154 (9.94)
14   4891 507827  85404 ( 14.52)   384  0    0 106  20   8   134 (2.74)  549  9048 (10.59)
13   6604 514431  80513 ( 13.68)   708  0    0 190  42  18   250 (3.79)  799  8914 (11.07)
12   7003 521434  73909 ( 12.56)   509  0    0 220  70  13   303 (4.33)  1102  8664 (11.72)
11   8755 530189  66906 ( 11.37)   830  0    0 510  95  38   643 (7.34)  1745  8361 (12.50)
10  11696 541885  58151 (  9.88)   990  0    0 689 207  32   928 (7.93)  2673  7718 (13.27)
 9  16233 558118  46455 (  7.90)  1699  0    0 1155 396  92   1643 (10.12)  4316  6790 (14.62)
 8  13320 571438  30222 (  5.14)  1047  0    0 1068 621  54   1743 (13.09)  6059  5147 (17.03)
 7  11590 583028  16902 (  2.87)   858  0    0 1147 827  33   2007 (17.32)  8066  3404 (20.14)
 6   4397 587425   5312 (  0.90)   649  0    0 633 418  13   1064 (24.20)  9130  1397 (26.30)
 4    700 588125    915 (  0.16)   158  0    0  97  27   4   128 (18.29)  9258  333 (36.39)
 0    215 588340    215 (  0.04)  2396  0   121   0  84   0   205 (95.35)  9463  205 (95.35)
-1    579 588919      0 (  0.00)  89440  0    0  64  63   0   127 (21.93)  9590    0 (0.00)


Read/contig alignment summary, by read base; adjusted qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
90 503027 503027 573000 (100.00)    16  0    0   0   0   0     0 (0.00)    0  6082 (1.06)
89    133 503160  69973 ( 12.21)     0  0    0   0   0   0     0 (0.00)    0  6082 (8.69)
88    401 503561  69840 ( 12.19)     0  0    0   0   0   0     0 (0.00)    0  6082 (8.71)
87    143 503704  69439 ( 12.12)     0  0    0   0   0   0     0 (0.00)    0  6082 (8.76)
86    232 503936  69296 ( 12.09)     0  0    0   0   0   0     0 (0.00)    0  6082 (8.78)
85    372 504308  69064 ( 12.05)     0  0    0   0   0   0     0 (0.00)    0  6082 (8.81)
84    281 504589  68692 ( 11.99)     0  0    0   0   0   0     0 (0.00)    0  6082 (8.85)
83    233 504822  68411 ( 11.94)     0  0    0   0   0   0     0 (0.00)    0  6082 (8.89)
82    140 504962  68178 ( 11.90)     0  0    0   0   0   0     0 (0.00)    0  6082 (8.92)
81   2031 506993  68038 ( 11.87)     2  0    0   0   0   0     0 (0.00)    0  6082 (8.94)
80     69 507062  66007 ( 11.52)     0  0    0   0   0   0     0 (0.00)    0  6082 (9.21)
79     85 507147  65938 ( 11.51)     0  0    0   0   0   0     0 (0.00)    0  6082 (9.22)
78     73 507220  65853 ( 11.49)     0  0    0   0   0   0     0 (0.00)    0  6082 (9.24)
77     72 507292  65780 ( 11.48)     0  0    0   0   0   0     0 (0.00)    0  6082 (9.25)
76    573 507865  65708 ( 11.47)     1  0    0   0   0   0     0 (0.00)    0  6082 (9.26)
75     79 507944  65135 ( 11.37)     1  0    0   0   0   0     0 (0.00)    0  6082 (9.34)
74     66 508010  65056 ( 11.35)     1  0    0   0   0   0     0 (0.00)    0  6082 (9.35)
73    199 508209  64990 ( 11.34)     1  0    0   0   0   0     0 (0.00)    0  6082 (9.36)
72     49 508258  64791 ( 11.31)     1  0    0   0   0   0     0 (0.00)    0  6082 (9.39)
71    193 508451  64742 ( 11.30)     6  0    0   0   0   0     0 (0.00)    0  6082 (9.39)
70     98 508549  64549 ( 11.27)     0  0    0   0   0   0     0 (0.00)    0  6082 (9.42)
69    172 508721  64451 ( 11.25)     1  0    0   0   0   0     0 (0.00)    0  6082 (9.44)
68     68 508789  64279 ( 11.22)     0  0    0   0   0   0     0 (0.00)    0  6082 (9.46)
67    201 508990  64211 ( 11.21)     0  0    0   0   0   0     0 (0.00)    0  6082 (9.47)
66   6486 515476  64010 ( 11.17)     4  0    0   0   0   0     0 (0.00)    0  6082 (9.50)
65    866 516342  57524 ( 10.04)     0  0    0   0   0   0     0 (0.00)    0  6082 (10.57)
64    133 516475  56658 (  9.89)     0  0    0   0   0   0     0 (0.00)    0  6082 (10.73)
63     38 516513  56525 (  9.86)     0  0    0   0   0   0     0 (0.00)    0  6082 (10.76)
62    240 516753  56487 (  9.86)     0  0    0   0   0   0     0 (0.00)    0  6082 (10.77)
61   1158 517911  56247 (  9.82)     1  0    0   0   0   0     0 (0.00)    0  6082 (10.81)
60    477 518388  55089 (  9.61)     1  0    0   0   0   0     0 (0.00)    0  6082 (11.04)
59    284 518672  54612 (  9.53)     3  0    0   0   0   0     0 (0.00)    0  6082 (11.14)
58    279 518951  54328 (  9.48)     0  0    0   0   0   0     0 (0.00)    0  6082 (11.19)
57    499 519450  54049 (  9.43)     6  0    0   0   0   0     0 (0.00)    0  6082 (11.25)
56    947 520397  53550 (  9.35)   146  0    0   0   0   0     0 (0.00)    0  6082 (11.36)
55    275 520672  52603 (  9.18)     1  0    0   0   0   0     0 (0.00)    0  6082 (11.56)
54    641 521313  52328 (  9.13)     0  0    0   0   0   0     0 (0.00)    0  6082 (11.62)
53    318 521631  51687 (  9.02)     1  0    0   0   0   0     0 (0.00)    0  6082 (11.77)
52    468 522099  51369 (  8.96)     0  0    0   0   0   0     0 (0.00)    0  6082 (11.84)
51    311 522410  50901 (  8.88)    67  0    0   0   0   0     0 (0.00)    0  6082 (11.95)
50    475 522885  50590 (  8.83)    16  0    0   0   0   0     0 (0.00)    0  6082 (12.02)
49    447 523332  50115 (  8.75)     2  0    0   0   0   0     0 (0.00)    0  6082 (12.14)
48    350 523682  49668 (  8.67)     4  0    0   0   0   0     0 (0.00)    0  6082 (12.25)
47    300 523982  49318 (  8.61)     2  0    0   0   0   0     0 (0.00)    0  6082 (12.33)
46    499 524481  49018 (  8.55)    27  0    0   0   0   0     0 (0.00)    0  6082 (12.41)
45    423 524904  48519 (  8.47)    27  0    0   0   0   0     0 (0.00)    0  6082 (12.54)
44    653 525557  48096 (  8.39)    23  0    0   0   0   0     0 (0.00)    0  6082 (12.65)
43    507 526064  47443 (  8.28)    25  0    0   0   0   0     0 (0.00)    0  6082 (12.82)
42    590 526654  46936 (  8.19)    49  0    0   0   0   1     1 (0.17)    1  6082 (12.96)
41    594 527248  46346 (  8.09)    14  0    0   0   0   0     0 (0.00)    1  6081 (13.12)
40  11555 538803  45752 (  7.98)    87  0    0   0   0   1     1 (0.01)    2  6081 (13.29)
39     86 538889  34197 (  5.97)     9  0    0   0   0   0     0 (0.00)    2  6080 (17.78)
38     96 538985  34111 (  5.95)     6  0    0   0   0   0     0 (0.00)    2  6080 (17.82)
37    130 539115  34015 (  5.94)    15  0    0   0   0   0     0 (0.00)    2  6080 (17.87)
36    116 539231  33885 (  5.91)     4  0    0   0   1   0     1 (0.86)    3  6080 (17.94)
35    247 539478  33769 (  5.89)    17  0    0   0   1   0     1 (0.40)    4  6079 (18.00)
34    296 539774  33522 (  5.85)    14  0    0   0   0   1     1 (0.34)    5  6078 (18.13)
33    284 540058  33226 (  5.80)    16  0    0   0   0   0     0 (0.00)    5  6077 (18.29)
32    287 540345  32942 (  5.75)     7  0    0   0   3   2     5 (1.74)   10  6077 (18.45)
31    128 540473  32655 (  5.70)    15  0    0   1   0   0     1 (0.78)   11  6072 (18.59)
30     65 540538  32527 (  5.68)    15  0    0   0   0   0     0 (0.00)   11  6071 (18.66)
29    212 540750  32462 (  5.67)    23  0    0   1   6   0     7 (3.30)   18  6071 (18.70)
28     88 540838  32250 (  5.63)    12  0    0   0   0   0     0 (0.00)   18  6064 (18.80)
27    232 541070  32162 (  5.61)    14  0    0   0   4   2     6 (2.59)   24  6064 (18.85)
26    126 541196  31930 (  5.57)    13  0    0   2   1   0     3 (2.38)   27  6058 (18.97)
25   1119 542315  31804 (  5.55)    25  0    0   3   2   2     7 (0.63)   34  6055 (19.04)
24    305 542620  30685 (  5.36)    13  0    0   4   7   0    11 (3.61)   45  6048 (19.71)
23    266 542886  30380 (  5.30)    15  0    0   4   6   0    10 (3.76)   55  6037 (19.87)
22    217 543103  30114 (  5.26)    25  0    0   8  11   1    20 (9.22)   75  6027 (20.01)
21    360 543463  29897 (  5.22)    32  0    0  14   2   1    17 (4.72)   92  6007 (20.09)
20    280 543743  29537 (  5.15)    20  0    0   2   6   3    11 (3.93)  103  5990 (20.28)
19    674 544417  29257 (  5.11)    49  0    0  11   8   5    24 (3.56)  127  5979 (20.44)
18    289 544706  28583 (  4.99)    28  0    0  15   5   2    22 (7.61)  149  5955 (20.83)
17    474 545180  28294 (  4.94)    28  0    0  13  12   3    28 (5.91)  177  5933 (20.97)
16    641 545821  27820 (  4.86)    37  0    0  21  19   5    45 (7.02)  222  5905 (21.23)
15    941 546762  27179 (  4.74)    67  0    0  52  19   8    79 (8.40)  301  5860 (21.56)
14    815 547577  26238 (  4.58)    34  0    0  46  12   7    65 (7.98)  366  5781 (22.03)
13   1429 549006  25423 (  4.44)    93  0    0  88  26  15   129 (9.03)  495  5716 (22.48)
12   1397 550403  23994 (  4.19)    56  0    0 109  48  12   169 (12.10)  664  5587 (23.28)
11   2254 552657  22597 (  3.94)   164  0    0 267  50  33   350 (15.53)  1014  5418 (23.98)
10   3223 555880  20343 (  3.55)   167  0    0 356 136  27   519 (16.10)  1533  5068 (24.91)
 9   5189 561069  17120 (  2.99)   130  0    0 616 231  77   924 (17.81)  2457  4549 (26.57)
 8   4447 565516  11931 (  2.08)    77  0    0 717 446  38   1201 (27.01)  3658  3625 (30.38)
 7   4712 570228   7484 (  1.31)    75  0    0 825 611  30   1466 (31.11)  5124  2424 (32.39)
 6   2030 572258   2772 (  0.48)    38  0    0 430 262  11   703 (34.63)  5827  958 (34.56)
 4    579 572837    742 (  0.13)     6  0    0  75  23   2   100 (17.27)  5927  255 (34.37)
 0    163 573000    163 (  0.03)     2  0   74   0  81   0   155 (95.09)  6082  155 (95.09)
-1  15919 588919      0 (  0.00)  104679  0   47 2444 960  57   3508 (22.04)  9590    0 (0.00)


Depth 0 regions:

Block histogram:
Qual   bases    cum    blocks
 35       1        1        1
 43      15       16        6
 45      12       28        9
 46       5       33       10
 47       1       34        9
 50       8       42       13
 51      75      117       23
 52      14      131       31
 53      26      157       40
 54      17      174       49
 55      39      213       56
 56     271      484       48
 57       5      489       49
 58       2      491       48
 59       6      497       49
 60      57      554       58
 61     231      785       83
 62       6      791       82
 63      10      801       85
 64      10      811       86
 65      11      822       90
 66    1081     1903       53
 67      16     1919       50
 68      13     1932       54
 69      10     1942       55
 70      16     1958       58
 71      19     1977       61
 72      12     1989       64
 73      17     2006       63
 74      26     2032       67
 75      21     2053       73
 76      70     2123       80
 77      19     2142       81
 78      28     2170       84
 79      21     2191       83
 80      23     2214       80
 81     214     2428       90
 82      28     2456       92
 83      45     2501      101
 84      52     2553      106
 85      65     2618      109
 86      42     2660      113
 87      26     2686      113
 88      67     2753      122
 89      24     2777      120
 90   41303    44080        1

SS region: 1298 (2.94%), flagged: 0 (0.00%)

Sites with total LLR scores < -3.0  [max pos LLR read, max neg LLR read]  (#discrep top reads, #discrep bottom reads):
  390     -3.3  [-3.3,  0.0]  (1, 0)
  883     -5.1  [-5.1,  0.0]  (0, 1)
 2183     -4.0  [-4.0,  0.0]  (0, 1)
 2340     -5.6  [-5.6,  0.0]  (0, 1)
 2860     -3.7  [-3.7,  0.0]  (0, 1)
 2946     -4.2  [-4.2,  0.0]  (1, 0)
 3344     -4.0  [-4.0,  0.0]  (0, 1)
 5003     -4.6  [-4.6,  0.0]  (0, 1)
 6033     -4.6  [-4.6,  0.0]  (0, 1)
 6504     -4.0  [-4.0,  0.0]  (0, 1)
 7567     -3.0  [-3.0,  0.0]  (0, 1)
 7726     -3.2  [-3.2,  0.0]  (1, 0)
 8549     -5.6  [-5.6,  0.0]  (0, 1)
 9171     -5.6  [-5.6,  0.0]  (0, 1)
 9494     -4.6  [-4.6,  0.0]  (0, 1)
 9936     -4.0  [-4.0,  0.0]  (0, 1)
11058     -4.0  [-4.0,  0.0]  (0, 1)
11083     -4.5  [-4.5,  0.0]  (0, 1)
11167     -4.0  [-4.0,  0.0]  (0, 1)
11495     -5.6  [-5.6,  0.0]  (0, 1)
11606     -4.0  [-4.0,  0.0]  (0, 1)
11611     -4.6  [-4.6,  0.0]  (0, 1)
11783     -3.1  [-3.1,  0.0]  (0, 1)
12234     -4.0  [-4.0,  0.0]  (0, 1)
12302     -3.5  [-3.5,  0.0]  (0, 1)
13811     -5.1  [-5.1,  0.0]  (0, 1)
15126     -4.0  [-4.0,  0.0]  (0, 1)
15218     -5.1  [-5.1,  0.0]  (0, 1)
16522     -3.4  [-3.4,  0.0]  (0, 1)
16573     -4.4  [-4.4,  0.0]  (0, 1)
16801     -4.0  [-4.0,  0.0]  (0, 1)
16821     -3.6  [-3.6,  0.0]  (0, 1)
16922     -3.6  [-3.6,  0.0]  (0, 1)
17221     -4.4  [-4.4,  0.0]  (0, 1)
17328     -3.7  [-3.7,  0.0]  (0, 1)
17859     -4.6  [-4.6,  0.0]  (0, 1)
18230     -3.2  [-3.2,  0.0]  (1, 0)
18601     -4.0  [-4.0,  0.0]  (1, 0)
18624     -3.3  [-3.3,  0.0]  (0, 1)
18839     -4.4  [-4.4,  0.0]  (0, 1)
19463     -4.4  [-4.4,  0.0]  (0, 1)
19638     -3.5  [-3.5,  0.0]  (0, 1)
19664     -4.0  [-4.0,  0.0]  (0, 1)
20032     -4.0  [-4.0,  0.0]  (0, 1)
20044     -4.4  [-4.4,  0.0]  (0, 1)
20154     -3.7  [-3.7,  0.0]  (0, 1)
20355     -7.2  [-4.0,  0.0]  (0, 2)
21197     -4.6  [-4.6,  0.0]  (0, 1)
21427     -4.0  [-4.0,  0.0]  (0, 1)
21985     -4.6  [-4.6,  0.0]  (0, 1)
22092     -3.5  [-3.5,  0.0]  (0, 1)
23310     -4.6  [-4.6,  0.0]  (0, 1)
23641     -4.6  [-4.6,  0.0]  (0, 1)
24122     -5.6  [-5.6,  0.0]  (0, 1)
24373     -4.4  [-4.4,  0.0]  (0, 1)
24650     -4.0  [-4.0,  0.0]  (0, 1)
25118     -4.0  [-4.0,  0.0]  (0, 1)
25476     -3.7  [-3.7,  0.0]  (0, 1)
25494     -5.8  [-4.0,  0.0]  (1, 1)
25694     -4.0  [-4.0,  0.0]  (0, 1)
25862     -4.6  [-4.6,  0.0]  (0, 1)
26159     -4.0  [-4.0,  0.0]  (0, 1)
26324     -5.6  [-5.6,  0.0]  (0, 1)
26373     -4.5  [-4.5,  0.0]  (0, 1)
26511     -4.0  [-4.0,  0.0]  (0, 1)
26679     -4.0  [-4.0,  0.0]  (0, 1)
26686     -4.0  [-4.0,  0.0]  (0, 1)
26805     -4.0  [-4.0,  0.0]  (0, 1)
26887     -4.0  [-4.0,  0.0]  (0, 1)
26942     -4.6  [-4.6,  0.0]  (0, 1)
27194     -3.4  [-3.4,  0.0]  (0, 1)
27235     -4.6  [-4.6,  0.0]  (0, 1)
27285     -3.6  [-2.0,  0.0]  (0, 2)
27334     -3.5  [-3.5,  0.0]  (0, 1)
27391     -4.6  [-4.6,  0.0]  (0, 1)
27735     -4.0  [-4.0,  0.0]  (0, 1)
27916     -8.5  [-4.5,  0.0]  (0, 2)
28284     -4.0  [-4.0,  0.0]  (0, 1)
28421     -4.0  [-4.0,  0.0]  (0, 1)
28509     -4.0  [-4.0,  0.0]  (0, 1)
28539     -7.9  [-4.0,  0.0]  (0, 3)
28999     -4.6  [-4.6,  0.0]  (0, 1)
29043     -4.0  [-4.0,  0.0]  (0, 1)
30485     -3.2  [-3.2,  0.0]  (1, 0)
30507     -4.5  [-4.5,  0.0]  (0, 1)
31354     -3.4  [-3.4,  0.0]  (0, 1)
31444     -4.4  [-4.4,  0.0]  (0, 1)
31984     -4.0  [-4.0,  0.0]  (0, 1)
31999     -5.1  [-2.9,  0.0]  (0, 2)
32281     -4.6  [-4.6,  0.0]  (0, 1)
33425     -4.8  [-2.9,  0.0]  (0, 2)
34141     -4.6  [-4.6,  0.0]  (0, 1)
34551     -4.0  [-4.0,  0.0]  (0, 1)
35084     -4.0  [-4.0,  0.0]  (0, 1)
36138     -5.1  [-5.1,  0.0]  (0, 1)
36241     -4.6  [-4.6,  0.0]  (0, 1)
36748     -4.0  [-4.0,  0.0]  (0, 1)
37956     -3.7  [-3.7,  0.0]  (0, 1)
38153     -3.2  [-3.2,  0.0]  (1, 0)
38155     -3.4  [-3.4,  0.0]  (0, 1)
38295     -4.0  [-4.0,  0.0]  (0, 1)
38693     -4.8  [-4.8,  0.0]  (0, 1)
38893     -7.5  [-4.6,  0.0]  (0, 2)
39029     -4.0  [-4.0,  0.0]  (0, 1)
39105     -4.0  [-4.0,  0.0]  (0, 1)
39195     -4.0  [-4.0,  0.0]  (0, 1)
39801     -4.0  [-4.0,  0.0]  (0, 1)
40049     -4.0  [-4.0,  0.0]  (0, 1)
40757     -4.8  [-4.8,  0.0]  (0, 1)
41426     -3.3  [-3.3,  0.0]  (0, 1)
41648     -4.0  [-4.0,  0.0]  (0, 1)
42112     -3.9  [-3.9,  0.0]  (0, 1)
42687     -4.0  [-4.0,  0.0]  (1, 0)
44065     -4.0  [-4.0,  0.0]  (0, 1)

Read/contig discrepancies (* = higher-quality): None.
0 lower quality discrepant sites.

Reads with neg LLR score, or confirmed or high-qual unaligned seg > 20 bases, or other problem:

(Lngths init HQ, CF unalgn segs); aligned contig pos [LLR score]; (terminal HQ, CF unalgn); read id; aligned read pos
| confirmed read segments | unaligned read segments matching elsewhere
 (LU = local unaligned, DU = distant unaligned, DA = distant aligned, ** = overlaps trimmed region
 || Best local and distant LLR scores
(0, 0)    38-  787 [-7.6] (0,0)     de120109r1         107-874 | (107 874)  999 1056 | DA:(999 1056) CHIMERIC || local(+/-) (9.0,0.0), distant (1.1,0.0)
LLR breakdown: discreps: -9.5 (<20 part: -9.5 (#=208), >20:0.0 (#=0); in HQ: -9.5, out HQ 0.0), match: 1.8  trail: 0.0  lead: 0.0  total: -7.7 
Bypassed: (0, 0)    13-   48 [-10.3] (16,0)     ce040109r1         64-99 || local(+/-) (0.5,0.0), distant (0.0,0.0)
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=1), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 0.7  trail: -11.1  lead: 0.0  total: -10.4 
(16, 0)   885- 1469 [-12.5] (0,0)   C ad030109r1         633-49 || local(+/-) (12.7,0.0), distant (0.0,0.0)
LLR breakdown: discreps: -0.3 (<20 part: -0.3 (#=3), >20:0.0 (#=0); in HQ: -0.3, out HQ 0.0), match: 13.0  trail: 0.0  lead: -25.2  total: -12.5 
(0, 0)   878-  882 [ 0.0] (0,0)   C ca070109r1         637-633 | 3 44 | LU: || local(+/-) (0.0,0.0), distant (0.0,0.0)
(0, 0)   781-  920 [-14.0] (14,0)     bc050109r1         51-192 || local(+/-) (3.0,0.0), distant (0.0,0.0)
LLR breakdown: discreps: -0.5 (<20 part: -0.5 (#=5), >20:0.0 (#=0); in HQ: -0.5, out HQ 0.0), match: 3.1  trail: -16.6  lead: 0.0  total: -14.0 
(0, 0)  1878- 1913 [-0.4] (9,15)   C ce050109f1         62-27 || local(+/-) (0.8,0.9), distant (0.0,0.0)
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 0.8  trail: -1.3  lead: 0.0  total: -0.5 
(0, 0)  1370- 1548 [-0.5] (620,0)   C cc080109r1         1041-853 | (338 668)  853 1041 | DA:(338 668) CHIMERIC || local(+/-) (3.4,0.0), distant (5.4,0.0)
LLR breakdown: discreps: -1.0 (<20 part: -1.0 (#=34), >20:0.0 (#=0); in HQ: 0.0, out HQ -1.0), match: 1.9  trail: -1.4  lead: 0.0  total: -0.5 
(0, 0)  1881- 1913 [-15.0] (16,14)     ce050109r1         51-83 || local(+/-) (0.0,0.9), distant (0.0,0.0)
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 0.7  trail: -15.8  lead: 0.0  total: -15.1 
(0, 0)  4827- 5613 [ 7.8] (0,0)     ah030109f1         126-921 | (8 103)  126 997 | DU:(8 103) [17 102  with   ah040109f1  21 108-- displ. 6139]  [29 103  with   ag120109f1  38 113-- displ. 4189]  [19 99  with   ac070109f1  16 97-- displ. 31660]  [18 90  with   af110109f1  29 101]  [25 88  with   af090109f1  23 87-- displ. 12221]  [8 102  with   ae120109f1  11 111]  CHIMERIC || local(+/-) (16.7,0.0), distant (0.0,0.0)
Bypassed: (16, 9)  6220- 6488 [-18.0] (0,0)   C ae090109r1         316-48 || local(+/-) (5.9,0.0), distant (0.0,0.0)
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=5), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 5.9  trail: 0.0  lead: -23.7  total: -18.0 
(1, 0)  6539- 6578 [-0.8] (7,8)   C eh090109f1         63-24 || local(+/-) (0.0,1.0), distant (0.0,0.0)
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 0.9  trail: -1.7  lead: 0.0  total: -0.8 
Bypassed: (14, 6)  6630- 6661 [-4.5] (0,0)   C eh100109r1         78-47 || local(+/-) (0.5,0.0), distant (0.0,0.0)
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 0.7  trail: 0.0  lead: -5.3  total: -4.6 
(0, 0)  6369- 6376 [ 0.0] (0,0)     ah110109f1         658-665 | 55 101 | LU:(60 101) || local(+/-) (0.0,0.8), distant (0.6,0.0)
(0, 0)  5965- 6515 [-6.7] (0,0)     ac020109f1         273-830 | (14 103)  269 830 | DU:(14 43)(85 103) [23 96  with   ah060109f1  27 103-- displ. 5123]  [14 102  with   af110109f1  25 113]  [23 88  with   ae080109f1  26 93]  [23 96  with   ah060109f1  27 103-- displ. 5123]  [54 99  with   ah040109f1  60 105-- displ. 5150]  [52 103  with   ag120109f1  64 113-- displ. 3201]  [14 102  with   af110109f1  25 113]  [23 88  with   ae080109f1  26 93]  || local(+/-) (8.9,0.8), distant (0.9,1.5)
LLR breakdown: discreps: -10.5 (<20 part: -10.5 (#=136), >20:0.0 (#=0); in HQ: 0.0, out HQ -10.5), match: 3.8  trail: 0.0  lead: 0.0  total: -6.7 
(0, 0)  6539- 6579 [-4.6] (14,7)     eh090109r1         46-86 || local(+/-) (0.0,1.0), distant (0.0,0.0)
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 0.9  trail: -5.6  lead: 0.0  total: -4.7 
(16, 0)  8697- 9049 [-12.7] (0,0)   C ae110109r1         405-53 || local(+/-) (7.7,0.0), distant (3.8,0.0)
LLR breakdown: discreps: -0.4 (<20 part: -0.4 (#=4), >20:0.0 (#=0); in HQ: -0.4, out HQ 0.0), match: 7.8  trail: 0.0  lead: -20.1  total: -12.7 
(0, 0)  8258- 9066 [14.4] (48,0)   C af110109f1         936-115 | (23 114)  115 936 | DU:(**23 114**) [52 96  with   ah110109f1  54 100]  [23 104  with   ah060109f1  14 98]  [30 102  with   ah030109f1  17 89]  [23 101  with   ac070109f1  8 87]  [26 114  with   ac020109f1  13 101]  [25 114  with   af090109f1  11 101]  [51 102  with   ae120109f1  48 99-- displ. 23582]  CHIMERIC || local(+/-) (16.9,7.7), distant (8.9,0.8)
(47, 0)  8994- 9852 [17.7] (0,0)     ag120109f1         114-979 | (16 114)  114 1065 | DU:(**16 113**) [39 114  with   ah030109f1  28 102-- displ. 4189]  [65 114  with   ac020109f1  51 102-- displ. 3201]  [16 98  with   ab100109f1  9 86]  CHIMERIC || local(+/-) (18.6,1.1), distant (0.0,0.2)
(0, 0)  9088- 9935 [15.5] (21,0)   C bd020109f1         975-117 | (27 118)  117 1008 | DA:(**27 116**) CHIMERIC || local(+/-) (19.1,0.0), distant (0.5,0.0)
(0, 0) 10368-10683 [ 1.7] (150,0)   C be040109f1         501-183 || local(+/-) (5.9,4.9), distant (0.0,0.0)
(0, 0) 10286-10945 [-0.3] (0,0)   C ae050109f1         842-181 || local(+/-) (11.7,0.0), distant (0.0,0.0)
LLR breakdown: discreps: -2.0 (<20 part: -2.0 (#=131), >20:0.0 (#=0); in HQ: -2.0, out HQ 0.0), match: 1.6  trail: 0.0  lead: 0.0  total: -0.4 
(0, 2) 10375-10678 [-11.9] (14,0)     bd120109r1         52-356 || local(+/-) (5.9,0.0), distant (0.0,0.0)
LLR breakdown: discreps: -0.3 (<20 part: -0.3 (#=6), >20:0.0 (#=0); in HQ: -0.2, out HQ -0.1), match: 6.7  trail: -18.3  lead: 0.0  total: -11.9 
(0, 0) 11200-11207 [ 0.0] (0,0)     ah060109f1         390-397 | 1 111 | LU:(1 104) || local(+/-) (1.7,0.0), distant (0.8,1.5)
(0, 0) 12518-12689 [-13.1] (15,7)     af100109r1         50-221 | (1 49)  50 233 | CHIMERIC || local(+/-) (3.2,0.0), distant (0.0,0.0)
LLR breakdown: discreps: -0.4 (<20 part: -0.4 (#=8), >20:0.0 (#=0); in HQ: -0.4, out HQ 0.0), match: 3.7  trail: -16.4  lead: 0.0  total: -13.1 
(16, 9) 17067-17435 [-13.2] (0,0)   C eh010109r1         412-44 || local(+/-) (8.3,0.0), distant (0.0,0.0)
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 8.2  trail: 0.0  lead: -21.5  total: -13.3 
(0, 16) 16832-17327 [-2.9] (0,0)     bc020109f1         26-523 || local(+/-) (9.6,0.0), distant (0.0,0.0)
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=4), >20:0.0 (#=0); in HQ: -0.1, out HQ 0.0), match: 11.0  trail: 0.0  lead: -13.9  total: -3.0 
(0, 0) 17026-17890 [15.3] (0,0)     af090109f1         103-974 | (12 102)  103 974 | DU:(12 102) [24 86  with   ah060109f1  29 92-- displ. 6107]  [24 88  with   ah030109f1  24 87-- displ. 12221]  [12 102  with   af110109f1  24 113]  [12 86  with   ac070109f1  10 84-- displ. 19439]  [28 88  with   ae120109f1  36 97]  CHIMERIC || local(+/-) (18.3,6.2), distant (0.0,0.0)
Bypassed: (0, 0) 18547-19036 [-5.9] (15,0)     ed110109r1         49-538 || local(+/-) (10.6,0.0), distant (0.0,0.0)
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 10.9  trail: -16.9  lead: 0.0  total: -6.0 
(0, 0) 18790-19663 [16.6] (126,0)   C bd060109f1         1034-151 | (25 153)  151 1058 | DA:(**25 150**) CHIMERIC || local(+/-) (19.5,4.8), distant (2.8,0.0)
Bypassed: (15, 0) 19643-19779 [-14.1] (0,0)   C eb060109r1         184-46 || local(+/-) (2.6,0.0), distant (0.0,0.0)
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=2), >20:0.0 (#=0); in HQ: -0.1, out HQ 0.0), match: 3.1  trail: 0.0  lead: -17.1  total: -14.1 
Bypassed: (0, 0) 19027-20031 [21.7] (0,0)   C ce020109r1         1049-44 || local(+/-) (21.8,0.0), distant (0.0,0.0)
Bypassed: (0, 0) 19042-20043 [22.0] (0,0)   C cc030109r1         1048-45 || local(+/-) (21.7,0.0), distant (0.0,0.0)
(0, 0) 20269-20433 [-10.3] (0,11)   C dh040109f1         191-26 || local(+/-) (3.3,2.3), distant (0.0,0.0)
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=1), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 3.7  trail: -14.0  lead: 0.0  total: -10.3 
(0, 0) 20275-20433 [-17.3] (16,11)     dh040109r1         60-221 | (1 51)  60 232 | CHIMERIC || local(+/-) (2.6,2.3), distant (0.0,0.0)
LLR breakdown: discreps: -0.4 (<20 part: -0.4 (#=5), >20:0.0 (#=0); in HQ: -0.3, out HQ -0.1), match: 3.5  trail: -20.4  lead: 0.0  total: -17.3 
(0, 0) 20497-21314 [17.1] (65,0)     dc100109f1         22-839 | 22 839  (840 1031) | DA:(**840 1031**) CHIMERIC || local(+/-) (18.0,0.0), distant (3.8,3.8)
(0, 0) 21360-21794 [-9.8] (16,0)     bb010109r1         49-484 || local(+/-) (9.6,0.0), distant (0.0,0.0)
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=3), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 9.6  trail: -19.5  lead: 0.0  total: -9.9 
(0, 0) 23818-24027 [-0.9] (0,0)   C ba090109r1         559-349 || local(+/-) (1.0,1.6), distant (0.0,0.0)
LLR breakdown: discreps: -1.6 (<20 part: -1.6 (#=54), >20:0.0 (#=0); in HQ: 0.0, out HQ -1.6), match: 0.6  trail: 0.0  lead: 0.0  total: -1.0 
Bypassed: (0, 0) 23885-24238 [-12.7] (16,0)     dg010109r1         45-398 | (2 46)  45 407 | CHIMERIC || local(+/-) (7.5,1.6), distant (0.0,0.0)
LLR breakdown: discreps: -0.8 (<20 part: -0.8 (#=8), >20:0.0 (#=0); in HQ: -0.8, out HQ 0.0), match: 7.7  trail: -19.7  total: -12.8 
Bypassed: (0, 0) 26835-26882 [-12.5] (16,0)     ae070109r1         47-94 || local(+/-) (0.9,0.0), distant (0.0,0.0)
LLR breakdown: discreps: -0.3 (<20 part: -0.3 (#=4), >20:0.0 (#=0); in HQ: -0.3, out HQ 0.0), match: 1.0  trail: -13.2  lead: 0.0  total: -12.5 
(16, 0) 27609-27878 [-14.3] (0,0)   C aa100109r1         319-50 || local(+/-) (5.9,0.0), distant (0.0,0.0)
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=2), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 6.0  trail: 0.0  lead: -20.3  total: -14.3 
(0, 8) 28177-28420 [-0.7] (0,0)     cf010109f1         26-269 || local(+/-) (5.2,0.0), distant (0.0,0.0)
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 5.4  trail: 0.0  lead: -6.2  total: -0.8 
(0, 0) 29680-29782 [ 2.0] (0,0)   C ab100109f1         189-87 | (10 87)  87 189 | DU:(10 86) [10 87  with   ag120109f1  15 97]  CHIMERIC || local(+/-) (1.8,1.7), distant (0.0,0.0)
(0, 0) 28967-29827 [-20.1] (0,0)   C ca060109r1         940-48 || local(+/-) (6.0,1.7), distant (0.0,0.0)
LLR breakdown: discreps: -34.9 (<20 part: -34.9 (#=214), >20:0.0 (#=0); in HQ: -1.1, out HQ -33.8), match: 14.7  trail: 0.0  lead: 0.0  total: -20.2 
(0, 0) 29409-29817 [ 7.3] (0,0)     ah070109r1         49-457 | 49 457  (524 897) | DA:(524 897) CHIMERIC || local(+/-) (8.8,2.8), distant (6.8,4.5)
(0, 0) 29680-29841 [-15.9] (16,0)     ab100109r1         50-211 | 50 211  (964 1072) | DA:(964 1072) CHIMERIC || local(+/-) (3.1,1.7), distant (0.0,2.0)
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=5), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 3.5  trail: -19.2  lead: 0.0  total: -15.9 
(16, 11) 30479-30842 [-15.7] (0,0)   C dd090109r1         409-47 | (3 48)  47 420 | CHIMERIC || local(+/-) (8.0,0.0), distant (4.5,0.0)
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=1), >20:0.0 (#=0); in HQ: -0.1, out HQ 0.0), match: 8.1  lead: -23.7  total: -15.7 
(0, 59) 31786-32648 [14.6] (0,0)   C ae120109f1         995-113 | (12 112)  113 1079 | DU:(12 112) [12 112  with   ah030109f1  7 101]  [49 100  with   af110109f1  50 101-- displ. 23582]  [37 98  with   af090109f1  27 87]  [54 108  with   ac070109f1  42 96]  CHIMERIC || local(+/-) (19.9,0.0), distant (0.0,0.0)
(11, 9) 34797-34911 [-1.1] (0,0)   C ef050109f1         136-22 || local(+/-) (1.7,0.0), distant (0.0,0.0)
LLR breakdown: discreps: -0.9 (<20 part: -0.9 (#=4), >20:0.0 (#=0); in HQ: -0.9, out HQ 0.0), match: 2.5  trail: 0.0  lead: -2.7  total: -1.1 
(16, 9) 36406-36664 [-14.2] (0,0)   C eh080109r1         305-47 | (9 46)  47 314 | CHIMERIC || local(+/-) (5.6,5.0), distant (0.0,0.0)
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 5.8  trail: 0.0  lead: -20.0  total: -14.2 
(0, 0) 36465-37437 [20.7] (0,0)     ac070109f1         102-1078 | (9 98)  102 1078 | DU:(9 98) [17 98  with   ah030109f1  18 98-- displ. 31660]  [9 88  with   af110109f1  22 100]  [11 85  with   af090109f1  11 85-- displ. 19439]  [43 97  with   ae120109f1  53 107]  CHIMERIC || local(+/-) (18.1,4.3), distant (0.0,0.0)
(0, 9) 36406-36664 [-7.2] (0,0)     eh080109f1         25-285 || local(+/-) (5.0,5.0), distant (0.0,0.0)
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=2), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 5.8  trail: 0.0  lead: -13.0  total: -7.2 
(0, 0) 37718-38073 [-6.6] (0,0)     ec040109r1         299-657 || local(+/-) (5.5,0.0), distant (0.0,0.0)
LLR breakdown: discreps: -10.3 (<20 part: -10.3 (#=99), >20:0.0 (#=0); in HQ: 0.0, out HQ -10.3), match: 3.6  trail: 0.0  lead: 0.0  total: -6.7 
(0, 0) 40612-40834 [-5.0] (2,14)   C bc120109f1         250-28 || local(+/-) (4.7,4.9), distant (0.0,0.0)
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=1), >20:0.0 (#=0); in HQ: -0.1, out HQ 0.0), match: 4.9  trail: -9.9  lead: 0.0  total: -5.1 
(16, 9) 40609-40884 [-15.2] (0,0)   C ca050109r1         321-46 || local(+/-) (6.2,0.0), distant (0.0,0.0)
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=1), >20:0.0 (#=0); in HQ: -0.1, out HQ 0.0), match: 6.1  trail: 0.0  lead: -21.3  total: -15.3 
Bypassed: (0, 0) 40612-40834 [-12.9] (16,14)     bc120109r1         53-276 || local(+/-) (4.6,4.9), distant (0.0,0.0)
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=5), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 4.9  trail: -17.8  lead: 0.0  total: -12.9 
(0, 0) 41553-42340 [14.4] (0,0)   C ae080109f1         906-112 | (1 110)  112 912 | DU:(1 110) [22 110  with   ah060109f1  22 110]  [1 94  with   ah040109f1  1 94]  [27 94  with   ac020109f1  22 87]  CHIMERIC || local(+/-) (16.5,0.0), distant (0.0,0.0)
(0, 0) 42297-43032 [ 4.2] (0,0)   C cc010109f1         928-181 | (48 93)  181 928 | DA:(48 93) CHIMERIC || local(+/-) (8.3,0.0), distant (0.0,0.0)
(2, 1) 43999-44073 [ 1.2] (0,0)   C bf060109f1         92-18 | 18 93  (1084 1135) | DA:(1084 1135) CHIMERIC || local(+/-) (1.6,1.5), distant (0.0,1.0)
(0, 0) 43158-44064 [ 4.0] (39,0)   C cc090109r1         1029-120 || local(+/-) (12.3,0.0), distant (0.0,0.0)
(1, 1) 43999-44080 [-0.6] (0,0)     bf060109r1         46-127 || local(+/-) (1.7,0.0), distant (0.0,0.0)
LLR breakdown: discreps: -0.3 (<20 part: -0.3 (#=3), >20:0.0 (#=0); in HQ: -0.3, out HQ 0.0), match: 1.8  lead: -2.1  total: -0.6 

Gaps in unique-read coverage:   I 43715- 43998

Subclone/read contig links and consistency checks (* = inconsistency; Contig 0 = singletons)
Max subclone size: 5000

Size histogram for consistent forward-reverse pairs (*** = inconsistent pairs)
  ***     0

 Consistent opp sense links (* = not used in chain, ** = multiple non-zero):