BLASTN 2.11.0+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: Tomato genome chromosomes (Build SL4.0) 13 sequences; 782,520,033 total letters Query= SLM12‐2 Length=47 Score E Sequences producing significant alignments: (Bits) Value SL4.0ch12 41.7 0.005 SL4.0ch03 34.4 0.82 >SL4.0ch12 Length=66688036 Score = 41.7 bits (22), Expect = 0.005 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand=Plus/Minus Query 26 AACGGTGGAAACTATTGAAAGG 47 |||||||||||||||||||||| Sbjct 3195288 AACGGTGGAAACTATTGAAAGG 3195267 Score = 38.1 bits (20), Expect = 0.063 Identities = 20/20 (100%), Gaps = 0/20 (0%) Strand=Plus/Plus Query 1 ATCTCATTCAACGCACACCA 20 |||||||||||||||||||| Sbjct 3195080 ATCTCATTCAACGCACACCA 3195099 >SL4.0ch03 Length=65298490 Score = 34.4 bits (18), Expect = 0.82 Identities = 18/18 (100%), Gaps = 0/18 (0%) Strand=Plus/Minus Query 30 GTGGAAACTATTGAAAGG 47 |||||||||||||||||| Sbjct 40638363 GTGGAAACTATTGAAAGG 40638346 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 17997953583 Database: Tomato genome chromosomes (Build SL4.0) Posted date: Mar 21, 2024 4:17 PM Number of letters in database: 782,520,033 Number of sequences in database: 13 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5